Ch 1Reproduction in Organisms
5-Mark Questions
Which type of reproduction is effective - Asexual or sexual and why?
Sexual reproduction is more effective for long-term survival and evolution because it generates genetic variation; asexual reproduction is effective for rapid increase in stable environments.
The unicellular organisms which reproduce by binary fission are considered immortal. Justify.
Unicellular organisms that reproduce by binary fission are considered immortal because they lack a segregated germ line and do not undergo an aging process in the traditional sense. When a unicellular organism like bacteria or amoeba divides by binary fission, each daughter cell is genetically identical to the parent and possesses the full genetic complement and cellular machinery. Since successive binary fissions can theoretically continue indefinitely under favorable conditions, the lineage never experiences senescence or death in the way multicellular organisms do. …
2-Mark Questions
Name an organism where cell division is itself a mode of reproduction.
Amoeba is an organism where cell division itself serves as a mode of reproduction. In amoeba, the unicellular body undergoes binary fission, a form of asexual reproduction where the parent cell divides into two identical daughter cells. This process involves mitotic division of the nucleus followed by division of the cytoplasm, resulting in two genetically identical offspring. Binary fission is a simple and rapid method of reproduction that allows amoeba to increase its population quickly under favorable conditions.
Name the phenomenon where the female gamete directly develops into a new organism with an avian example.
The phenomenon where the female gamete directly develops into a new organism without fertilization is called parthenogenesis. An avian example is the domestic turkey (Meleagris gallopavo), where unfertilized eggs can develop into offspring. In this process, the haploid egg undergoes mitotic divisions to produce a diploid organism, bypassing the need for male gamete fusion. This form of asexual reproduction is particularly common in certain bird species and some other animals.
What is parthenogenesis? Give two examples from animals.
Parthenogenesis is the development of an embryo from an unfertilized egg without the fusion of male and female gametes. It is a form of asexual reproduction where the haploid egg undergoes mitotic divisions to produce a diploid organism. Examples of parthenogenesis in animals include drones (male bees) of the honey bee (Apis), where males develop from unfertilized eggs, certain aphids that reproduce parthenogenetically during favorable seasons, and some whiptail lizards (genus Aspidoscelis) where certain species reproduce entirely through parthenogenesis without males.
1-Mark Questions (MCQ)
Differentiate between the following: (a) External and Internal fertilization (b) Regeneration in lizard and Planaria
(a) External fertilization: gametes fuse outside body (aquatic animals, many fishes/amphibians), many small gametes, often large number of offspring and less parental care. Internal fertilization: gametes fuse inside body (terrestrial animals, mammals, birds), fewer gametes, greater parental care. (b) Regeneration: Lizard — limited regeneration (mainly tail) via blastema; replacement is partial and tissue types more restricted. Planaria — extensive regeneration: any small fragment can regenerate whole organism due to abundant pluripotent neoblasts.
Ch 2Human Reproduction
5-Mark Questions
Mention the differences between spermiogenesis and spermatogenesis.
Spermatogenesis and spermiogenesis are two distinct phases of male gamete formation. Spermatogenesis is the entire process of formation of male gametes from spermatogonial stem cells through a series of mitotic and meiotic divisions. It involves three main stages: mitotic proliferation of spermatogonia to produce primary spermatocytes, the first meiotic division producing secondary spermatocytes, and the second meiotic division producing haploid spermatids. …
At what stage of development are the gametes formed in newborn male and female?
In the newborn male, germ cells are present as spermatogonial stem cells, also called gonocytes or spermatogonia, which remain mitotically quiescent and dormant until the onset of puberty. These cells are located in the seminiferous tubules of the testes but do not undergo active division or differentiation at birth. Spermatogenesis does not begin until puberty when hormonal stimulation triggers the activation and proliferation of these spermatogonial stem cells. …
2-Mark Questions
A - In human male, testes are extra abdominal and lie in scrotal sacs. R - Scrotum acts as thermoregulator and keeps temperature lower by 2°C for normal sperm production. Choose correct relation.
A and R are true, R is the correct explanation of A
A - Ovulation is the release of ovum from the Graafian follicle. R - It occurs during the follicular phase of the menstrual cycle. Choose correct relation.
A is true, R is false
A - Head of the sperm consists of acrosome and mitochondria. R - Acrosome contains spiral rows of mitochondria. Choose correct relation.
Both A and R are false
1-Mark Questions (MCQ)
The following is the illustration of the sequence of ovarian events (a-i) in a human female. a) Identify the figure that illustrates ovulation and mention the stage of oogenesis it represents. b) Name the ovarian hormone and the pituitary hormone that have caused the above-mentioned events. c) Explain the changes that occurs in the uterus simultaneously in anticipation. d) Write the difference between C and H.
a) The figure showing the ruptured mature (Graafian) follicle illustrates ovulation; it represents release of a secondary oocyte arrested in metaphase II. b) Ovarian hormone: estrogen (produced by the mature follicle); Pituitary hormone: LH (luteinizing hormone surge). c) Uterine changes: endometrium moves from proliferative to secretory phase under progesterone (after corpus luteum forms): becomes thicker, more glandular and vascularized; glands secrete nutrient-rich fluid preparing for implantation. …
Ch 3Reproductive Health
5-Mark Questions
Correct the following statements a) Transfer of an ovum collected from donor into the fallopian tube is called ZIFT. b) Transfering of an embryo with more than 8 blastomeres into uterus is called GIFT. c) Multiload 375 is a hormone releasing IUD.
The following corrections address common misconceptions about assisted reproductive techniques and contraceptive devices. For statement a, ZIFT (Zygote Intrafallopian Transfer) specifically refers to the transfer of a fertilized ovum or zygote into the fallopian tube, not an unfertilized ovum. The transfer of unfertilized ova and sperms together into the fallopian tube is called GIFT (Gamete Intrafallopian Transfer), which is the reverse of what was stated. …
Which method do you suggest the couple to have a baby, if the male partner fails to inseminate the female or due to very low sperm count in the ejaculate?
For a couple facing male factor infertility due to failure to inseminate or very low sperm count in the ejaculate, assisted reproductive techniques are the most appropriate recommendation. Intracytoplasmic Sperm Injection (ICSI) is particularly suitable in this scenario, as it involves the direct injection of a single spermatozoon into the cytoplasm of a mature oocyte during in vitro fertilization (IVF). …
2-Mark Questions
Select the correct term from the bracket and complete the given branching tree Birth control methods Condoms, vaults, Caps etc., Pills Vasectomy B Coitus interruptus Periodic abstinence Natural methods A Oral contraceptives Surgical methods IUDs (Barriers, Lactational amenorrhoea, CuT, Tubectomy) 44 Reprod u c t i v e Health 7HPSRUDU\ PHWKRG 3HUPDQHQW 0HWKRG 7XEHFWRP\ 9DVHFWRP\ 3URJHVWDVHUW /1* &X 7 $ 1RYD 7 &X &X7 $J 0XOWLORDG +RUPRQDO EDUULHU 'LDSKUDJP &HUYLFDO FDS 9DXOWV &RQGRP 0HFKDQLFDO EDUULHU %DUULHU PHWKRG &KHPLFDO EDUULHU 3HULRGLF DEVWLQHQFH UK\WKP PHWKRG &RQWLQXRXV DEVWLQHQFH &RLWXV LQWHUUXSWXV /DFWDWLRQDO $PHQRUUKRHD 1DWXUDO PHWKRG 2UDO FRQWUDFHSWLYHV %,57+ &21752/ 0(7+2'6 1RQ PHGLFDWHG ,8'V +RUPRQDO UHOHDVLQJ ,8'V &RSSHU UHOHDVLQJ ,8'V /LSSHV ORRS 0LQL SLOOV 6DKHOL FHQWFKURPDQ )RDPLQJ WDEOHWV PHOWLQJ VXSSRVLWRULHV MHOOLHV DQG FUHDPV ,QWUDXWHULQH 'HYLFHV
A — Barriers (e.g., condoms, caps, vaults) B — Lactational amenorrhoea (natural method) C — CuT (IUD) D — Tubectomy (surgical method)
Expand the following a) ZIFT b) ICSI
a) ZIFT stands for Zygote Intrafallopian Transfer, a technique in which a fertilized ovum or zygote is collected and transferred into the fallopian tube to allow natural development and implantation. b) ICSI stands for Intracytoplasmic Sperm Injection, a specialized micromanipulation technique used in assisted reproduction in which a single sperm is injected directly into the cytoplasm of a mature oocyte to achieve fertilization, particularly useful in cases of severe male factor infertility.
1-Mark Questions (MCQ)
Open Book Assessment: 'Healthy reproduction, legally checked birth control measures and proper family planning programmes are essential for the survival of mankind.' Justify.
Healthy reproduction, legally regulated birth control measures, and proper family planning programmes are essential for mankind's survival for several interconnected reasons. Healthy reproduction ensures that children are born with minimal genetic and developmental abnormalities, reducing infant and child mortality and promoting the birth of healthy individuals who can contribute productively to society. Legally checked birth control measures prevent unsafe and unregulated practices that endanger women's health and lives. …
Ch 4Principles of Inheritance and Variation
5-Mark Questions
Distinguish between heterogametic and homogametic sex determination systems.
Heterogametic Sex: * Organisms producing two different types of gametes. * Example: Human male. Sperm with X chromosome Sperm with Y chromosome Homogametic Sex: * Organisms producing only one type of gametes. * Example: Human female. Every egg produced contain X chromosomes.
Explain the genetic basis of ABO blood grouping in man.
The ABO blood grouping system in humans is controlled by a single gene with three alleles designated as I^A, I^B, and i. These alleles show codominance and complete dominance relationships. The I^A and I^B alleles are codominant to each other, meaning both are expressed when present together. Both I^A and I^B alleles are completely dominant over the recessive i allele. The four possible blood groups result from different combinations of these three alleles. Blood group A individuals have genotype I^A I^A or I^A i, possessing A antigens on red blood cells. …
2-Mark Questions
What is haplodiploidy?
In haplodiploidy, the sex of the offspring is determined by the number of sets of chromosomes it receives. Fertilized eggs develop into females (Queen or Worker) and unfertilized eggs develop into males (drones) by parthenogenesis. It means that the males have half the number of chromosomes (haploid) and the females have double the number (diploid).
What is Lyonisation?
Lyonisation is the process of inactivation or silencing of one of the two X chromosomes in female mammals. In female cells, one X chromosome is randomly selected and becomes highly condensed into a structure called a Barr body, rendering most of its genes transcriptionally inactive. This process occurs early in female development and is random, meaning that in some cells the maternal X chromosome is inactivated while in other cells the paternal X chromosome is inactivated. …
What is criss-cross inheritance?
Criss-cross inheritance is the pattern of inheritance of X-linked genes where the trait appears to skip generations or pass from one sex to the other in an alternating pattern. In this inheritance pattern, a gene is transmitted from an affected male parent to his carrier daughter (who is phenotypically normal if the allele is recessive) and then to an affected grandson through the daughter. Alternatively, a carrier female can pass the recessive allele to her son who expresses the trait, and then the trait can reappear in the granddaughter if she inherits the allele from her affected father. …
1-Mark Questions (MCQ)
Explain the inheritance of sex linked characters in human being.
Sex-linked characters in humans are traits controlled by genes located on the sex chromosomes, primarily the X chromosome. Since males have only one X chromosome (XY), they express both dominant and recessive alleles on the X chromosome, making them hemizygous. Females have two X chromosomes (XX), so they can be homozygous or heterozygous for X-linked traits. For X-linked recessive traits like color blindness and hemophilia, affected males have the genotype X^a Y where X^a represents the recessive allele. …
Ch 5Molecular Genetics
5-Mark Questions
Give reasons: Genetic code is 'universal'.
The genetic code is considered universal because nearly all organisms, from bacteria to plants to animals, use the same codon–amino acid assignments. A given codon specifies the same amino acid in bacteria, plants, and animals, demonstrating that the fundamental mechanism of protein synthesis is conserved across all domains of life. This universality suggests a common evolutionary origin of all living organisms and indicates that the genetic code was established early in evolution and has remained largely unchanged. …
Name the parts marked 'A' and 'B' in the given transcription unit: 5' 3' A 3' 5' B
In the given transcription unit, A represents the coding strand (also called the sense or non-template strand) with polarity 5' → 3', and B represents the template strand (also called the antisense strand) with polarity 3' → 5'. The template strand (B) is the strand that serves as the template for RNA synthesis by RNA polymerase. RNA polymerase reads the template strand in the 3' to 5' direction and synthesizes mRNA in the 5' to 3' direction, with the mRNA sequence being complementary and antiparallel to the template strand. …
2-Mark Questions
If the coding sequence in a transcription unit is written as follows: 5' TGCATGCATGCATGCATGCATGCATGC 3' Write down the sequence of mRNA.
The mRNA sequence transcribed from the given DNA coding sequence is synthesized in the 5'→3' direction, with uracil replacing thymine. Since the DNA coding sequence is 5' TGCATGCATGCATGCATGCATGCATGC 3', the corresponding mRNA sequence (5'→3') is 5' UGCAUGCAUGCAUGCAUGCAUGCAUGC 3', where each thymine (T) in the DNA is replaced by uracil (U) in the RNA, and all other bases remain the same.
1-Mark Questions (MCQ)
It is established that RNA is the first genetic material. Justify giving reasons.
RNA is considered the first genetic material because it can both store information and act as a catalyst (ribozyme), can self-replicate under plausible prebiotic conditions, and modern evidence (ribozymes, central role of RNA in translation) supports an RNA world preceding DNA/protein biology.
Ch 6Evolution
5-Mark Questions
Explain the three major categories in which fossilization occur?
Fossilization occurs through three major categories of processes. First, permineralization or petrifaction occurs when mineral-rich water permeates the porous tissues of dead organisms; minerals precipitate within the tissues and gradually replace the organic material while preserving the original structure and form, commonly seen in petrified wood where silica minerals fill and replace the wood cells. …
Differentiate between divergent evolution and convergent evolution with one example for each.
Divergent evolution and convergent evolution represent two contrasting patterns of evolutionary change. Divergent evolution occurs when related species that share a common ancestor evolve different traits and adaptations as they become isolated and experience different environmental pressures, resulting in the development of homologous structures that are similar in basic structure and embryological origin but different in form and function. …
2-Mark Questions
List out the major gases seems to be found in the primitive earth.
Major gases of primitive Earth: methane (CH4), ammonia (NH3), hydrogen (H2), water vapour (H2O), nitrogen (N2) and carbon dioxide (CO2).
1-Mark Questions (MCQ)
How does Neanderthal man differ from the modern man in appearance?
Neanderthal man (Homo neanderthalensis) differed from modern humans (Homo sapiens) in several significant anatomical features. Neanderthals were more robust and heavily built with a stockier body structure adapted to cold climates, whereas modern humans are more gracile and lightly built. Neanderthals possessed heavy, prominent brow ridges above their eyes, while modern humans have smooth foreheads. The forehead of Neanderthals was low and receding, sloping backward, whereas modern humans have a vertical, prominent forehead. …
Ch 7Human Health and Diseases
5-Mark Questions
Name and explain the type of barriers which involve macrophages.
The type of barrier that involves macrophages is called the cellular or phagocytic innate immune barrier. Macrophages are large specialized cells derived from monocytes that function as professional phagocytes, capable of engulfing and destroying pathogens, dead cells, and cellular debris. These cellular barriers operate as part of the innate immune system, providing non-specific defense against a wide range of microorganisms and foreign substances. …
What are interferons? Mention their role.
Interferons are a group of cytokines, which are small signaling proteins produced by virus-infected cells and certain immune cells such as lymphocytes and macrophages. These molecules play crucial roles in antiviral defense and immune regulation. When a cell is infected by a virus, it produces interferons that are secreted and bind to receptors on neighboring uninfected cells, triggering the production of antiviral proteins that inhibit viral replication and protein synthesis. This creates an antiviral state in neighboring cells, preventing the spread of infection. …
2-Mark Questions
Given below are some human organs. Identify one primary and one secondary lymphoid organ. Explain its role. Liver, thymus, stomach, thyroid, tonsils
From the given organs, thymus is a primary lymphoid organ and tonsils are a secondary lymphoid organ. The thymus is a primary lymphoid organ located in the chest behind the breastbone where T lymphocytes (T cells) develop and mature. In the thymus, immature T cells undergo selection processes that ensure they can recognize self-antigens appropriately while eliminating those that would attack the body's own cells, thus achieving immunocompetency. The thymus is particularly active during childhood and gradually decreases in size and function with age. …
A patient was hospitalized with fever and chills. Merozoites were observed in her blood. What is your diagnosis?
The diagnosis is malaria, an infectious disease caused by Plasmodium species parasites. The presence of merozoites in the blood is a characteristic finding that confirms malaria infection. Merozoites are the asexual stage of the Plasmodium parasite that are released from infected red blood cells and invade new erythrocytes, causing their rupture and the characteristic fever and chills associated with malaria. …
1-Mark Questions (MCQ)
Why do you think it is not possible to produce vaccine against 'common cold'?
It is not possible to produce an effective vaccine against the common cold due to several interconnected factors related to viral diversity and immune response characteristics. The common cold is caused by more than 100 different virus serotypes, primarily rhinoviruses, but also including coronaviruses, adenoviruses, enteroviruses, and parainfluenza viruses. This extreme antigenic diversity means that immunity to one serotype does not provide protection against others, making a single vaccine impractical. …
Ch 8Microbes in Human Welfare
5-Mark Questions
How is milk converted into curd? Explain the process of curd formation.
Milk is converted into curd through a fermentation process called lactic acid fermentation, carried out by lactic acid bacteria used as starter cultures. The primary bacteria involved are Lactobacillus bulgaricus and Streptococcus thermophilus, which are added to warm milk at approximately 40-45 degrees Celsius. These bacteria metabolize lactose, the primary sugar in milk, through anaerobic fermentation, producing lactic acid as the end product. The accumulation of lactic acid lowers the pH of the milk to approximately 4.6, creating an acidic environment. …
Give any two bioactive molecules produced by microbes and state their uses.
Microorganisms produce numerous bioactive molecules with significant medical and industrial applications. Penicillin is produced by the fungus Penicillium notatum or Penicillium chrysogenum and is a beta-lactam antibiotic that inhibits bacterial cell wall synthesis by binding to penicillin-binding proteins and preventing peptidoglycan cross-linking. It is used to treat a wide range of bacterial infections caused by gram-positive and some gram-negative bacteria, making it one of the most important antibiotics in clinical medicine. …
1-Mark Questions (MCQ)
What is bioremediation?
Bioremediation is an environmental biotechnology approach that uses living organisms, primarily microorganisms such as bacteria and fungi, and plants to degrade, detoxify, or remove pollutants and contaminants from contaminated environments. The process can be implemented through two main strategies: in situ bioremediation, where contamination is treated at the site of pollution without removing the contaminated material, and ex situ bioremediation, where contaminated soil or water is excavated or extracted and treated in a controlled facility away from the original site. …
Ch 9Applications of Biotechnology
5-Mark Questions
Mention the number of primers required in each cycle of PCR. Write the role of primers and DNA polymerase in PCR. Name the source organism of the DNA polymerase used in PCR.
Two primers are required in each cycle of PCR: a forward primer and a reverse primer. Primers are short synthetic oligonucleotide sequences, typically 18-25 nucleotides long, that are complementary to the flanking sequences at the ends of the target DNA region to be amplified. The primers serve the critical role of providing a free 3'-OH group that acts as the starting point for DNA synthesis, allowing DNA polymerase to recognize where to begin synthesis and ensuring that amplification is specific to the desired target sequence. …
How is the amplification of a gene sample of interest carried out using PCR?
PCR amplification of a gene sample of interest is carried out through a series of carefully controlled steps. The reaction mixture is prepared by combining template DNA containing the target sequence, two specific primers (forward and reverse) that flank the region of interest, deoxynucleotide triphosphates (dNTPs) providing the building blocks for DNA synthesis, a buffer solution maintaining optimal pH, magnesium ions (Mg2+) as cofactors for DNA polymerase activity, and heat-stable DNA polymerase, typically Taq polymerase from Thermus aquaticus. …
1-Mark Questions (MCQ)
Explain how recombinant insulin can be produced.
Recombinant insulin is produced through a multi-step biotechnological process that involves genetic engineering and protein expression in microbial hosts. The first step is to identify and isolate the human insulin gene or the genes encoding the individual insulin A and B chains, or alternatively, the proinsulin gene, which encodes a single-chain precursor that is later processed into mature insulin. …
Ch 10Organisms and Populations
5-Mark Questions
Define ecological niche.
An ecological niche is the role or functional position of a species in an ecosystem, encompassing its habitat, the resources it utilizes, its interactions with other species, and its contribution to energy flow and nutrient cycling. It defines not just where an organism lives but how it lives, including what it eats, when it is active, how it reproduces, and how it influences and is influenced by its biotic and abiotic environment. …
Explain hibernation and aestivation with examples.
Hibernation is a seasonal winter dormancy characterized by a dramatic reduction in metabolic rate, body temperature, and physical activity, allowing organisms to survive periods of food scarcity and extreme cold. During hibernation, heart rate and breathing slow considerably, and the organism relies on stored energy reserves such as fat. Examples include bears, ground squirrels, hedgehogs, and some bats that enter hibernation in autumn and emerge in spring. Aestivation is a similar dormancy strategy but occurs during summer to avoid heat stress and desiccation rather than cold. …
2-Mark Questions
What is a Habitat?
A habitat is the specific place or physical environment where an organism or a population normally lives, survives, and reproduces. It encompasses the particular location and all the biotic and abiotic factors present in that location that the organism requires for its survival and growth. For example, a pond serves as the habitat for a frog, providing water, aquatic vegetation, insects for food, and appropriate temperature conditions. An oak tree is the habitat for a woodpecker, offering shelter in cavities, insects for food, and suitable nesting sites. …
What is Acclimatisation?
Acclimatisation is the reversible physiological, morphological or behavioural adjustment of an individual organism to changes in its environment. These adjustments occur within the lifetime of an organism and allow it to cope with environmental stress or variation. A classic example is the increase in red blood cell production in humans at high altitude, which enhances oxygen-carrying capacity in response to lower atmospheric oxygen. …
What is Pedogenesis?
Pedogenesis is the process of soil formation from parent rock through physical, chemical and biological weathering combined with the accumulation of organic matter. Physical weathering involves the mechanical breakdown of rock by temperature fluctuations, frost action, and water erosion. Chemical weathering occurs through oxidation, hydrolysis, and dissolution of minerals by water and acids. Biological weathering is facilitated by plant roots, lichens, fungi, and soil microorganisms that break down rock and contribute organic material. …
1-Mark Questions (MCQ)
Tabulate and analysis of two species population interaction.
Two-species population interactions can be analyzed and tabulated based on the effects on each species, represented by + (positive effect), − (negative effect), or 0 (no effect). Competition (−/−) occurs when both species are negatively affected as they utilize the same limited resources, reducing fitness and survival of both. Predation and parasitism (+/−) involve one species (predator or parasite) benefiting while the other (prey or host) is harmed; the predator gains nutrition while the prey population decreases. …
Ch 11Biodiversity and its Conservation
5-Mark Questions
Define the following. a. Species richness. b. Endemism.
a. Species richness: The number of different species present in a given area or community. b. Endemism: The condition of a species being native to and restricted to a particular geographic region.
"Amazon forest is considered to be the lungs of the planet"-Justify this statement.
The Amazon forest is often called the lungs of the planet because of its critical role in global oxygen production and carbon cycling. The Amazon possesses immense primary productivity and biomass, with millions of trees and plants continuously photosynthesizing and converting large amounts of atmospheric carbon dioxide into organic matter while releasing oxygen as a byproduct. This massive photosynthetic activity makes the Amazon one of the world's largest oxygen producers. …
2-Mark Questions
How many hotspots are there in India? Name them.
Two hotspots: Western Ghats and Eastern Himalayas.
What are the three levels of biodiversity?
The three levels of biodiversity are genetic diversity, species diversity, and ecosystem diversity. Genetic diversity refers to the variation in genes within a population or species, including different alleles and genetic combinations that provide the raw material for evolution and adaptation. Species diversity encompasses the variety of different species present in an area or on Earth, measured by species richness and evenness. …
Name the active chemical found in the medicinal plant Rauwolfia vomitoria. What type of diversity it belongs to?
The active chemical found in the medicinal plant Rauwolfia vomitoria is reserpine, an alkaloid used in treating hypertension and psychiatric disorders. Reserpine exemplifies biochemical diversity, which is a facet of genetic diversity. Biochemical diversity refers to the variety of chemical compounds and metabolites produced by different organisms, reflecting the genetic differences that encode the enzymes and pathways for synthesizing these compounds. This diversity has immense value for medicine, agriculture, and industry.
1-Mark Questions (MCQ)
Write a note on (i) Protected areas and (ii) Wildlife Sanctuaries.
Protected areas are designated regions of land or water specifically managed for the conservation of biodiversity, ecosystem services, and genetic resources. They include national parks, wildlife sanctuaries, biosphere reserves, and other conservation designations. Protected areas function as in situ conservation sites where species are protected within their natural habitats and ecological communities are maintained. …
Ch 12Environmental Issues
5-Mark Questions
What is SMOG and how it is harmful for us?
Smog is a form of air pollution that results from a mixture of smoke, fog, and photochemical pollutants. It typically forms when sunlight reacts with nitrogen oxides and volatile organic compounds in the atmosphere, producing secondary pollutants including ground-level ozone, peroxyacetyl nitrate (PAN), and various particulate matter. Smog appears as a visible haze that reduces atmospheric visibility and can range in color from gray to brown depending on pollutant composition. Smog is harmful to human health in multiple ways. …
List all the wastes that you generate, at home, school or during your trips to other places. Could you very easily reduce the generation of these wastes? Which would be difficult or rather impossible to reduce?
Common wastes generated at home include organic wastes such as kitchen scraps, food leftovers, and yard waste; paper products including newspapers, cardboard, and office paper; plastic items such as bags, bottles, containers, and packaging materials; glass bottles and jars; metal cans and containers; electronic waste including batteries, chargers, mobile phones, and computer components; sanitary waste such as diapers and menstrual products; textiles including worn clothing and fabric scraps; and hazardous household chemicals including cleaning products, pesticides, and paint. …
2-Mark Questions
Expand (i) CFC (ii) AQI (iii) PAN
CFC = Chlorofluorocarbon; AQI = Air Quality Index; PAN = Peroxyacetyl nitrate (Peroxyacyl nitrates).
1-Mark Questions (MCQ)
In which of the following phyla, the adult shows radial symmetry but the larva shows bilateral symmetry? a. Mollusca b. Echinodermata c. Arthropoda d. Annelida
b) Echinodermata Explanation: Echinoderm adults (e.g., sea stars, sea urchins) display radial (usually pentaradial) symmetry, whereas their larvae (for example, bipinnaria or pluteus larvae) are bilaterally symmetrical. This change reflects their planktonic larval stage and sedentary/adult body plan.
Frequently asked questions
- Which type of reproduction is effective - Asexual or sexual and why?
- Sexual reproduction is more effective for long-term survival and evolution because it generates genetic variation; asexual reproduction is effective for rapid increase in stable environments.
- The unicellular organisms which reproduce by binary fission are considered immortal. Justify.
- Unicellular organisms that reproduce by binary fission are considered immortal because they lack a segregated germ line and do not undergo an aging process in the traditional sense. When a unicellular organism like bacteria or amoeba divides by binary fission, each daughter cell is genetically identical to the parent and possesses the full genetic complement and cellular machinery. Since successive binary fissions can theoretically continue indefinitely under favorable conditions, the lineage never experiences senescence or death in the way multicellular organisms do. …
- Name an organism where cell division is itself a mode of reproduction.
- Amoeba is an organism where cell division itself serves as a mode of reproduction. In amoeba, the unicellular body undergoes binary fission, a form of asexual reproduction where the parent cell divides into two identical daughter cells. This process involves mitotic division of the nucleus followed by division of the cytoplasm, resulting in two genetically identical offspring. Binary fission is a simple and rapid method of reproduction that allows amoeba to increase its population quickly under favorable conditions.
- Name the phenomenon where the female gamete directly develops into a new organism with an avian example.
- The phenomenon where the female gamete directly develops into a new organism without fertilization is called parthenogenesis. An avian example is the domestic turkey (Meleagris gallopavo), where unfertilized eggs can develop into offspring. In this process, the haploid egg undergoes mitotic divisions to produce a diploid organism, bypassing the need for male gamete fusion. This form of asexual reproduction is particularly common in certain bird species and some other animals.
These important questions are selected from the Samacheer Kalvi Class 12 Zoology textbook book-back exercises to help you revise the most useful questions. Mark weightage (5/2/1) follows the usual exam pattern and may vary by exam — always check your latest syllabus and question pattern. Open each chapter for the complete set of questions and answers.