Practice Question Papers · with Answers

Samacheer Kalvi Class 12 Zoology Practice Question Papers

Download free Samacheer Kalvi Class 12 Zoology practice question papers with full answer keys. These are original Brain Grain model papers — built from our verified question bank to the real exam blueprint (sections, marks and solutions) — perfect for board revision and model tests. For the actual board papers, use the official links below.

Brain Grain · braingrain.in
Zoology — Practice Paper · Set 1
Class: 12Samacheer KalviMax Marks: 92
Name: ____________________Reg No: ____________
Part I — Multiple Choice Questions 14 × 1 = 14

Choose the correct answer. (Answer all questions.)

1.In which of the following phyla, the adult shows radial symmetry but the larva shows bilateral symmetry? a. Mollusca b. Echinodermata c. Arthropoda d. Annelida[1]
2.It is established that RNA is the first genetic material. Justify giving reasons.[1]
3.What is bioremediation?[1]
4.How does Neanderthal man differ from the modern man in appearance?[1]
5.What are the effects of noise pollution?[1]
6.Explain how recombinant insulin can be produced.[1]
7.Why do you think it is not possible to produce vaccine against 'common cold'?[1]
8.Open Book Assessment: 'Healthy reproduction, legally checked birth control measures and proper family planning programmes are essential for the survival of mankind.' Justify.[1]
9.Write a note on (i) Protected areas and (ii) Wildlife Sanctuaries.[1]
10.Differentiate between the following: (a) External and Internal fertilization (b) Regeneration in lizard and Planaria[1]
11.Tabulate and analysis of two species population interaction.[1]
12.Explain the inheritance of sex linked characters in human being.[1]
13.The following is the illustration of the sequence of ovarian events (a-i) in a human female. a) Identify the figure that illustrates ovulation and mention the stage of oogenesis it represents. b) Name the ovarian hormone and the pituitary hormone that have caused the above-mentioned events. c) Explain the changes that occurs in the uterus simultaneously in anticipation. d) Write the difference between C and H.[1]
14.Explain the different kinds of syngamy in living organisms.[1]
Part II — Short Answer Questions 14 × 2 = 28

Answer briefly. (Answer all questions.)

15.A - In human male, testes are extra abdominal and lie in scrotal sacs. R - Scrotum acts as thermoregulator and keeps temperature lower by 2°C for normal sperm production. Choose correct relation.[2]
16.Name an organism where cell division is itself a mode of reproduction.[2]
17.List out the major gases seems to be found in the primitive earth.[2]
18.Mention the symptoms of Down's syndrome.[2]
19.A patient was hospitalized with fever and chills. Merozoites were observed in her blood. What is your diagnosis?[2]
20.How is sex determined in human beings?[2]
21.What is soil permeability?[2]
22.Why is the offspring formed by asexual reproduction referred as a clone?[2]
23.What are the three levels of biodiversity?[2]
24.What are the applications of Karyotyping?[2]
25.How many hotspots are there in India? Name them.[2]
26.Why are sex linked recessive characters more common in the male human beings?[2]
27.Name the active chemical found in the medicinal plant Rauwolfia vomitoria. What type of diversity it belongs to?[2]
28.Expand the acronyms a. FSH b. LH c. hCG d. hPL[2]
Part III — Long Answer Questions 10 × 5 = 50

Answer in detail. (Answer all questions.)

29.What is SMOG and how it is harmful for us?[5]
30.In north eastern states, the jhum cultivation is a major threat to biodiversity - substantiate the statement.[5]
31.How does Hardy-Weinberg's expression (p2+2pq+q2=1) explain that genetic equilibrium is maintained in a population? List any four factors that can disturb the genetic equilibrium.[5]
32.Explain the genetic basis of ABO blood grouping in man.[5]
33.State any three goals of the human genome project.[5]
34.At what stage of development are the gametes formed in newborn male and female?[5]
35.Mention any two ways in which single nucleotide polymorphism (SNPs) identified in human genome can bring revolutionary change in biological and medical science.[5]
36.How is the amplification of a gene sample of interest carried out using PCR?[5]
37.Give any two bioactive molecules produced by microbes and state their uses.[5]
38.Correct the following statements a) Transfer of an ovum collected from donor into the fallopian tube is called ZIFT. b) Transfering of an embryo with more than 8 blastomeres into uterus is called GIFT. c) Multiload 375 is a hormone releasing IUD.[5]
🔑 Show Answer Key — Set 1
  1. 1. b) Echinodermata Explanation: Echinoderm adults (e.g., sea stars, sea urchins) display radial (usually pentaradial) symmetry, whereas their larvae (for example, bipinnaria or pluteus larvae) are bilaterally symmetrical. This change reflects their planktonic larval stage and sedentary/adult body plan.
  2. 2. RNA is considered the first genetic material because it can both store information and act as a catalyst (ribozyme), can self-replicate under plausible prebiotic conditions, and modern evidence (ribozymes, central role of RNA in translation) supports an RNA world preceding DNA/protein biology.
  3. 3. Bioremediation is an environmental biotechnology approach that uses living organisms, primarily microorganisms such as bacteria and fungi, and plants to degrade, detoxify, or remove pollutants and contaminants from contaminated environments. The process can be implemented through two main strategies: in situ bioremediation, where contamination is treated at the site of pollution without removing the contaminated material, and ex situ bioremediation, where contaminated soil or water is excavated or extracted and treated in a controlled facility away from the original site. Microorganisms employed in bioremediation possess enzymatic capabilities to break down various pollutants including petroleum hydrocarbons from oil spills, pesticides and herbicides, heavy metals through bioaccumulation or biotransformation, and even synthetic polymers like plastics. Bacteria such as Pseudomonas and other genera can metabolize complex organic pollutants as energy sources, converting them into less toxic or non-toxic compounds. Plants can absorb and accumulate heavy metals in their tissues through phytoremediation, or their associated rhizosphere microorganisms can degrade organic contaminants. Bioremediation is advantageous because it is cost-effective, environmentally sustainable, and can be applied to various types of contamination in soil, water, and sediments, making it an important tool in environmental restoration and pollution control.
  4. 4. Neanderthal man (Homo neanderthalensis) differed from modern humans (Homo sapiens) in several significant anatomical features. Neanderthals were more robust and heavily built with a stockier body structure adapted to cold climates, whereas modern humans are more gracile and lightly built. Neanderthals possessed heavy, prominent brow ridges above their eyes, while modern humans have smooth foreheads. The forehead of Neanderthals was low and receding, sloping backward, whereas modern humans have a vertical, prominent forehead. Neanderthals had a large nose, which may have been an adaptation for warming cold air before it entered the lungs, while modern humans have a smaller, more prominent nose. Neanderthals displayed an occipital bun, a projection at the back of the skull, which is absent in modern humans. The mid-face of Neanderthals projected forward, giving them a protruding appearance, whereas modern humans have a more retracted mid-face. Most distinctively, Neanderthals lacked a prominent chin, having a receding chin region, while modern humans possess a well-developed, projecting chin. These anatomical differences reflect different evolutionary pressures and adaptations, with Neanderthals being specialized for cold environments while modern humans show features associated with increased cognitive capacity and refined tool use.
  5. 5. Noise pollution produces a wide range of harmful effects on both human health and wildlife. Auditory effects include hearing loss, which can result from prolonged exposure to loud sounds, and tinnitus, a persistent ringing in the ears that can significantly impact quality of life. Physiological stress responses occur when organisms are exposed to excessive noise, leading to elevated blood pressure, increased heart rate, and elevated levels of stress hormones such as cortisol. These physiological changes can contribute to cardiovascular disease and other stress-related health conditions. Sleep disturbance is a major consequence of noise pollution, as continuous or intermittent loud sounds prevent individuals from achieving adequate rest, which is essential for physical and mental health. Chronic sleep deprivation due to noise exposure can lead to fatigue, reduced cognitive function, and increased susceptibility to illness. Reduced work efficiency and concentration are observed in individuals exposed to noise pollution, as the brain's ability to focus and process information is compromised. Behavioral impacts include increased irritability, anxiety, and aggression in both humans and animals. In wildlife, noise pollution disrupts communication between animals, interferes with mating and feeding behaviors, and can cause animals to abandon their habitats. Marine animals are particularly affected by underwater noise from ships and industrial activities, which disrupts their echolocation and navigation systems. Overall, noise pollution represents a significant environmental stressor with far-reaching consequences for the health and well-being of organisms across ecosystems.
  6. 6. Recombinant insulin is produced through a multi-step biotechnological process that involves genetic engineering and protein expression in microbial hosts. The first step is to identify and isolate the human insulin gene or the genes encoding the individual insulin A and B chains, or alternatively, the proinsulin gene, which encodes a single-chain precursor that is later processed into mature insulin. The isolated insulin gene or cDNA is then inserted into an expression vector, which is a plasmid or viral DNA construct containing regulatory sequences such as promoters and terminators that control gene expression. The recombinant expression vector is introduced into a suitable microbial host cell, most commonly Escherichia coli (E. coli) bacteria or yeast cells such as Saccharomyces cerevisiae, which are chosen for their rapid growth, ease of genetic manipulation, and ability to produce large quantities of recombinant protein. The host cells are cultured in fermentation vessels under controlled conditions of temperature, pH, and nutrient availability to maximize protein expression. The expressed insulin or proinsulin is then harvested from the cultured cells and purified using chromatographic techniques such as gel filtration, ion exchange chromatography, and reverse-phase high-performance liquid chromatography (HPLC) to remove bacterial proteins and other contaminants. If proinsulin was expressed, it must be processed enzymatically or chemically to remove the connecting C-peptide, generating the mature insulin molecule consisting of the A and B chains linked by disulfide bonds. If the A and B chains were expressed separately, they must be chemically or enzymatically linked and refolded to form the correct three-dimensional structure with proper disulfide bond formation. The final purified and properly folded recombinant insulin is then formulated, sterilized, and packaged for pharmaceutical use. This biotechnological approach has revolutionized insulin production, providing a safe, abundant, and cost-effective supply of insulin for the treatment of diabetes mellitus, eliminating the previous dependence on insulin extracted from animal pancreases.
  7. 7. It is not possible to produce an effective vaccine against the common cold due to several interconnected factors related to viral diversity and immune response characteristics. The common cold is caused by more than 100 different virus serotypes, primarily rhinoviruses, but also including coronaviruses, adenoviruses, enteroviruses, and parainfluenza viruses. This extreme antigenic diversity means that immunity to one serotype does not provide protection against others, making a single vaccine impractical. Additionally, these viruses undergo frequent antigenic variation and mutation, allowing them to evade previously acquired immunity. The common cold viruses primarily infect the upper respiratory tract, where mucosal immunity (mediated by secretory IgA antibodies) is the primary defense mechanism. However, mucosal immunity is short-lived and wanes relatively quickly, providing only temporary protection. Furthermore, the economic burden of developing and maintaining vaccines against so many different serotypes would be prohibitive given that the common cold is generally self-limiting and causes minimal mortality. The combination of high viral diversity, rapid antigenic variation, short-lived mucosal immunity, and the mild nature of the disease makes vaccine development against the common cold impractical and economically unfeasible.
  8. 8. Healthy reproduction, legally regulated birth control measures, and proper family planning programmes are essential for mankind's survival for several interconnected reasons. Healthy reproduction ensures that children are born with minimal genetic and developmental abnormalities, reducing infant and child mortality and promoting the birth of healthy individuals who can contribute productively to society. Legally checked birth control measures prevent unsafe and unregulated practices that endanger women's health and lives. Proper family planning programmes enable couples to space pregnancies appropriately, reducing maternal and child health risks associated with frequent pregnancies and allowing adequate recovery time between births. These measures help maintain sustainable population levels that do not exceed the carrying capacity of available resources and environment. When population growth is controlled through planned parenthood, resources such as food, water, education, and healthcare can be distributed more equitably, preventing scarcity and conflict. Environmental degradation caused by overpopulation is minimized, preserving ecosystems and natural resources for future generations. Socioeconomic development is facilitated when families are smaller and resources can be invested in education, healthcare, and economic opportunities rather than being stretched across too many dependents. Women's health, education, and empowerment improve when they have control over their reproductive choices. Collectively, these factors ensure demographic stability, environmental sustainability, and socioeconomic progress, all of which are fundamental requirements for the long-term survival and prosperity of mankind.
  9. 9. Protected areas are designated regions of land or water specifically managed for the conservation of biodiversity, ecosystem services, and genetic resources. They include national parks, wildlife sanctuaries, biosphere reserves, and other conservation designations. Protected areas function as in situ conservation sites where species are protected within their natural habitats and ecological communities are maintained. They serve multiple purposes including preserving representative ecosystems, protecting endangered species, maintaining ecosystem services such as water purification and carbon sequestration, supporting scientific research, and providing educational opportunities. Protected areas are managed according to conservation plans that may restrict human activities to varying degrees depending on the designation and management objectives. Wildlife sanctuaries are a specific category of protected areas where the primary aim is protection of wildlife and their habitats. In sanctuaries, the focus is on preserving animal species and maintaining suitable habitat conditions for their survival and reproduction. Unlike national parks, wildlife sanctuaries may allow certain regulated human activities such as controlled grazing, collection of non-timber forest products, and limited resource use by local communities, provided these activities do not significantly harm wildlife populations. Sanctuaries typically have less stringent restrictions than national parks but stricter protections than unprotected areas. The management of sanctuaries involves monitoring wildlife populations, controlling poaching, managing habitat quality, and balancing conservation needs with the rights and livelihoods of local communities. Both protected areas and wildlife sanctuaries are essential components of biodiversity conservation strategies, functioning as refugia for species and maintaining ecological integrity in increasingly fragmented landscapes.
  10. 10. (a) External fertilization: gametes fuse outside body (aquatic animals, many fishes/amphibians), many small gametes, often large number of offspring and less parental care. Internal fertilization: gametes fuse inside body (terrestrial animals, mammals, birds), fewer gametes, greater parental care. (b) Regeneration: Lizard — limited regeneration (mainly tail) via blastema; replacement is partial and tissue types more restricted. Planaria — extensive regeneration: any small fragment can regenerate whole organism due to abundant pluripotent neoblasts.
  11. 11. Two-species population interactions can be analyzed and tabulated based on the effects on each species, represented by + (positive effect), − (negative effect), or 0 (no effect). Competition (−/−) occurs when both species are negatively affected as they utilize the same limited resources, reducing fitness and survival of both. Predation and parasitism (+/−) involve one species (predator or parasite) benefiting while the other (prey or host) is harmed; the predator gains nutrition while the prey population decreases. Mutualism (+/+) is a mutually beneficial interaction where both species gain advantages, such as flowering plants and their pollinators or nitrogen-fixing bacteria and legumes. Commensalism (+/0) benefits one species while the other is unaffected, as seen when epiphytic plants grow on trees without harming them. Amensalism (−/0) harms one species while leaving the other unaffected, such as when antibiotic-producing microorganisms inhibit competitors. Neutralism (0/0) occurs when two species coexist with no effect on each other. These interactions shape community structure, influence species distribution and abundance, and drive ecological succession and evolution. Understanding these interactions is essential for predicting ecosystem responses to environmental changes and managing biodiversity.
  12. 12. Sex-linked characters in humans are traits controlled by genes located on the sex chromosomes, primarily the X chromosome. Since males have only one X chromosome (XY), they express both dominant and recessive alleles on the X chromosome, making them hemizygous. Females have two X chromosomes (XX), so they can be homozygous or heterozygous for X-linked traits. For X-linked recessive traits like color blindness and hemophilia, affected males have the genotype X^a Y where X^a represents the recessive allele. Carrier females have the genotype X^A X^a (one normal and one mutant allele) and typically show the dominant phenotype but can pass the recessive allele to offspring. When a carrier female (X^A X^a) mates with a normal male (X^A Y), the offspring show a 1:1 ratio in males (half normal X^A Y and half affected X^a Y) and all females are normal phenotypically (half X^A X^A and half X^A X^a carriers). When an affected female (X^a X^a) mates with a normal male (X^A Y), all daughters are carriers (X^A X^a) and all sons are affected (X^a Y). This criss-cross inheritance pattern explains why X-linked recessive traits appear more frequently in males than females. The inheritance of X-linked dominant traits differs because affected heterozygous females (X^A X^a) pass the dominant allele to half their offspring of both sexes, while affected males (X^A Y) pass the dominant allele to all daughters but no sons.
  13. 13. a) The figure showing the ruptured mature (Graafian) follicle illustrates ovulation; it represents release of a secondary oocyte arrested in metaphase II. b) Ovarian hormone: estrogen (produced by the mature follicle); Pituitary hormone: LH (luteinizing hormone surge). c) Uterine changes: endometrium moves from proliferative to secretory phase under progesterone (after corpus luteum forms): becomes thicker, more glandular and vascularized; glands secrete nutrient-rich fluid preparing for implantation. d) Difference between C and H (assumed C = corpus luteum; H = corpus albicans): corpus luteum is yellow, functional, secretes progesterone and some estrogen; corpus albicans is a pale fibrous scar (degenerate corpus luteum), non-functional and hormone-inactive.
  14. 14. Syngamy refers to the fusion of two gametes to form a zygote, and different types of syngamy are classified based on the morphology and motility of the fusing gametes. Isogamy is the fusion of two morphologically similar and equally motile gametes, as seen in many algae and fungi where both gametes appear identical. Anisogamy involves the fusion of two gametes that differ in size and morphology, where one gamete is larger and less motile than the other, observed in certain algae and protozoans. Oogamy is the fusion of a large, non-motile female gamete (ovum) with a small, motile male gamete (sperm), which is the most common type of syngamy in higher animals and plants. These different types of syngamy reflect variations in sexual reproduction strategies across different organisms.
  15. 15. A and R are true, R is the correct explanation of A
  16. 16. Amoeba is an organism where cell division itself serves as a mode of reproduction. In amoeba, the unicellular body undergoes binary fission, a form of asexual reproduction where the parent cell divides into two identical daughter cells. This process involves mitotic division of the nucleus followed by division of the cytoplasm, resulting in two genetically identical offspring. Binary fission is a simple and rapid method of reproduction that allows amoeba to increase its population quickly under favorable conditions.
  17. 17. Major gases of primitive Earth: methane (CH4), ammonia (NH3), hydrogen (H2), water vapour (H2O), nitrogen (N2) and carbon dioxide (CO2).
  18. 18. Down's syndrome, also called trisomy 21, is a chromosomal disorder caused by the presence of three copies of chromosome 21 instead of the normal two copies. The characteristic symptoms include severe mental retardation or intellectual disability of varying degrees. Affected individuals show defective development of the central nervous system, resulting in developmental delays and learning difficulties. Distinctive facial features include increased separation between the eyes (hypertelorism), a flattened nose with a low nasal bridge, and malformed ears that may be small or positioned lower than normal. The mouth is characteristically held open and the tongue protrudes, a condition called macroglossia. Additional features often include short stature, poor muscle tone (hypotonia), congenital heart defects, and increased susceptibility to infections. Individuals with Down's syndrome may also have hearing and vision problems. Despite these challenges, many individuals with Down's syndrome can learn to perform daily activities and some can be employed with appropriate support and education.
  19. 19. The diagnosis is malaria, an infectious disease caused by Plasmodium species parasites. The presence of merozoites in the blood is a characteristic finding that confirms malaria infection. Merozoites are the asexual stage of the Plasmodium parasite that are released from infected red blood cells and invade new erythrocytes, causing their rupture and the characteristic fever and chills associated with malaria. The fever and chills pattern corresponds to the synchronized rupture of infected red blood cells at regular intervals, typically every 48 or 72 hours depending on the Plasmodium species involved. Microscopic examination of blood smears showing merozoites, along with clinical symptoms of fever and chills, is a standard diagnostic method for malaria confirmation.
  20. 20. Sex determination in humans follows an XY chromosomal system where males are heterogametic and females are homogametic. Females have two X chromosomes (XX) and produce eggs that all contain a single X chromosome. Males have one X chromosome and one Y chromosome (XY) and produce two types of sperm, approximately half carrying an X chromosome and half carrying a Y chromosome. During fertilization, if an X-bearing sperm fertilizes an egg, the resulting zygote has an XX chromosome combination and develops as a female. If a Y-bearing sperm fertilizes an egg, the resulting zygote has an XY chromosome combination and develops as a male. Therefore, the sex of the offspring is determined by the male parent, as the sperm contributes either an X or Y chromosome. The Y chromosome carries the sex-determining region (SRY gene) which triggers the development of male characteristics. In the absence of the Y chromosome and SRY gene, the default developmental pathway results in female characteristics. This chromosomal mechanism of sex determination is consistent and reliable, producing approximately equal numbers of male and female offspring in populations.
  21. 21. Soil permeability is the ability of soil to allow water and gases to pass through its pore spaces, which is essential for water drainage, aeration, and nutrient availability to plant roots. Permeability depends on several factors including soil texture (the proportion of sand, silt, and clay particles), soil structure (the arrangement and aggregation of particles), and pore connectivity (the degree to which pores are interconnected). Sandy soils generally have high permeability due to larger pore spaces, while clay soils have low permeability because fine particles create smaller, less connected pores. Soil structure, influenced by organic matter content and biological activity, can significantly modify permeability. Proper soil permeability is critical for plant growth, as it affects water availability, oxygen diffusion, and the leaching of nutrients and contaminants.
  22. 22. The offspring formed by asexual reproduction are referred to as clones because they are genetically identical to the parent organism and to each other. Asexual reproduction occurs through mitosis, which produces daughter cells with the exact same genetic information as the parent cell. Since no genetic recombination or variation occurs during mitotic division, all offspring are genetically uniform copies of the parent. A clone is defined as a group of genetically identical individuals derived from a single parent through asexual reproduction, making this term particularly appropriate for describing the products of asexual reproduction.
  23. 23. The three levels of biodiversity are genetic diversity, species diversity, and ecosystem diversity. Genetic diversity refers to the variation in genes within a population or species, including different alleles and genetic combinations that provide the raw material for evolution and adaptation. Species diversity encompasses the variety of different species present in an area or on Earth, measured by species richness and evenness. Ecosystem diversity refers to the variety of different ecosystems, habitats, and biomes present across the biosphere, each with unique communities and ecological processes.
  24. 24. Karyotyping helps in gender identification. * It is used to detect the chromosomal aberrations like deletion, duplication, translocation, non-disjunction of chromosomes. * It helps to identify the abnormalities of chromosomes like aneuploidy. * It is also used in predicting the evolutionary relationships between species. * Genetic diseases in human beings can be detected by this technique.
  25. 25. Two hotspots: Western Ghats and Eastern Himalayas.
  26. 26. Sex-linked recessive characters are more common in male human beings because males have only one X chromosome (XY), whereas females have two X chromosomes (XX). In males, a single recessive allele on the X chromosome is expressed phenotypically because there is no corresponding allele on the Y chromosome to mask it. Males are therefore hemizygous for X-linked genes, meaning they have only one copy of each X-linked gene. In contrast, females require two copies of a recessive allele (one on each X chromosome) to express the recessive phenotype. If a female has only one recessive allele, she is a carrier and typically expresses the dominant phenotype. This fundamental difference in chromosome composition makes males much more likely to display X-linked recessive traits such as colour blindness and haemophilia, even though the allele frequency may be the same in both sexes.
  27. 27. The active chemical found in the medicinal plant Rauwolfia vomitoria is reserpine, an alkaloid used in treating hypertension and psychiatric disorders. Reserpine exemplifies biochemical diversity, which is a facet of genetic diversity. Biochemical diversity refers to the variety of chemical compounds and metabolites produced by different organisms, reflecting the genetic differences that encode the enzymes and pathways for synthesizing these compounds. This diversity has immense value for medicine, agriculture, and industry.
  28. 28. a. FSH — Follicle Stimulating Hormone b. LH — Luteinizing Hormone c. hCG — human Chorionic Gonadotropin d. hPL — human Placental Lactogen
  29. 29. Smog is a form of air pollution that results from a mixture of smoke, fog, and photochemical pollutants. It typically forms when sunlight reacts with nitrogen oxides and volatile organic compounds in the atmosphere, producing secondary pollutants including ground-level ozone, peroxyacetyl nitrate (PAN), and various particulate matter. Smog appears as a visible haze that reduces atmospheric visibility and can range in color from gray to brown depending on pollutant composition. Smog is harmful to human health in multiple ways. It causes respiratory irritation affecting the nose, throat, and lungs, triggering coughing and discomfort. It aggravates pre-existing respiratory conditions such as asthma and chronic bronchitis, increasing the frequency and severity of symptoms. Smog reduces lung function, decreasing the amount of oxygen the lungs can process, which is particularly dangerous for children, elderly people, and those with respiratory diseases. Eye irritation is common, causing redness, watering, and discomfort. Prolonged exposure to smog increases the risk of developing respiratory diseases and cardiovascular problems. Additionally, smog damages vegetation by interfering with photosynthesis and causing leaf damage, reducing crop yields and affecting plant growth. It also reduces visibility, creating hazards for transportation and visibility-dependent activities. Smog formation is exacerbated in areas with high vehicular traffic, industrial emissions, and stagnant atmospheric conditions, making it a significant public health concern in urban areas.
  30. 30. Jhum (shifting or slash‑and‑burn) cultivation causes deforestation, soil erosion, loss of primary forest and species, habitat fragmentation and decreases biodiversity; repeated cycles reduce soil fertility and prevent forest recovery.
  31. 31. Hardy–Weinberg principle: For a gene with two alleles A and a, let p = frequency of A and q = frequency of a (p + q = 1). Under ideal conditions (large population, random mating, no mutation, no migration, no selection) genotype frequencies after one generation are p2 (AA), 2pq (Aa) and q2 (aa), and these proportions remain constant generation to generation (p2 + 2pq + q2 = 1). Thus allele and genotype frequencies are in genetic equilibrium when Hardy–Weinberg assumptions hold. Four factors that can disturb genetic equilibrium: 1) Mutation — introduces new alleles or changes frequencies. 2) Gene flow (migration) — movement of individuals/alleles between populations alters frequencies. 3) Genetic drift — random changes in allele frequencies in small populations (bottleneck, founder effect). 4) Natural selection or non-random mating (including inbreeding) — differential reproductive success or mate choice changes genotype and allele frequencies.
  32. 32. The ABO blood grouping system in humans is controlled by a single gene with three alleles designated as I^A, I^B, and i. These alleles show codominance and complete dominance relationships. The I^A and I^B alleles are codominant to each other, meaning both are expressed when present together. Both I^A and I^B alleles are completely dominant over the recessive i allele. The four possible blood groups result from different combinations of these three alleles. Blood group A individuals have genotype I^A I^A or I^A i, possessing A antigens on red blood cells. Blood group B individuals have genotype I^B I^B or I^B i, possessing B antigens on red blood cells. Blood group AB individuals have genotype I^A I^B, possessing both A and B antigens on red blood cells due to codominance of the two alleles. Blood group O individuals have genotype ii, lacking both A and B antigens. The plasma of each blood group contains naturally occurring antibodies against the antigens that are absent from their own red blood cells. Blood group A individuals have anti-B antibodies, blood group B individuals have anti-A antibodies, blood group AB individuals have no anti-A or anti-B antibodies, and blood group O individuals have both anti-A and anti-B antibodies. This genetic basis explains the inheritance patterns of blood groups and the compatibility requirements for blood transfusions.
  33. 33. The Human Genome Project (HGP) had three major goals. First, to determine the complete sequence of human DNA, including all approximately three billion base pairs and their order in the human genome. Second, to identify and map all human genes, determining their locations on chromosomes and understanding their functions and organization within the genome. Third, to develop comprehensive databases, bioinformatics tools, and analytical methods for organizing, storing, and analyzing the vast amount of genomic data generated, while simultaneously addressing the ethical, legal, and social issues (ELSI) arising from genetic knowledge, such as issues of privacy, genetic discrimination, and informed consent in genetic testing and research.
  34. 34. In the newborn male, germ cells are present as spermatogonial stem cells, also called gonocytes or spermatogonia, which remain mitotically quiescent and dormant until the onset of puberty. These cells are located in the seminiferous tubules of the testes but do not undergo active division or differentiation at birth. Spermatogenesis does not begin until puberty when hormonal stimulation triggers the activation and proliferation of these spermatogonial stem cells. In the newborn female, oocytes are present as primary oocytes that are arrested in the prophase I stage (specifically the dictyate or diplotene stage) of meiosis I. These primary oocytes remain suspended in this arrested state within primordial and primary follicles of the ovary until puberty. Each primary oocyte is surrounded by a single layer of follicle cells and is enclosed within a zona pellucida. The primary oocytes remain in this meiotic arrest until ovulation occurs, when the completion of meiosis I and progression to metaphase II takes place.
  35. 35. Single nucleotide polymorphisms (SNPs) identified in the human genome can bring revolutionary changes in biological and medical science in several ways. First, pharmacogenomics uses SNPs to predict individual drug responses and drug metabolism variations, enabling personalized medicine where treatments and drug doses can be tailored to an individual's genetic profile, thereby improving therapeutic efficacy and reducing adverse drug reactions. Second, disease risk assessment and diagnosis involve identifying SNPs through genome-wide association studies (GWAS) that serve as biomarkers for susceptibility to complex diseases such as diabetes, heart disease, and Alzheimer's disease, allowing for early detection, risk stratification, and preventive interventions. Additionally, SNPs can help identify genetic variations associated with disease progression and treatment response, facilitating the development of targeted therapies and improving clinical outcomes through precision medicine approaches.
  36. 36. PCR amplification of a gene sample of interest is carried out through a series of carefully controlled steps. The reaction mixture is prepared by combining template DNA containing the target sequence, two specific primers (forward and reverse) that flank the region of interest, deoxynucleotide triphosphates (dNTPs) providing the building blocks for DNA synthesis, a buffer solution maintaining optimal pH, magnesium ions (Mg2+) as cofactors for DNA polymerase activity, and heat-stable DNA polymerase, typically Taq polymerase from Thermus aquaticus. The amplification process involves repeated thermal cycling with three distinct temperature phases. During denaturation at approximately 94-95°C, the double-stranded DNA template separates into single strands. In the annealing phase at 50-65°C (the exact temperature depends on primer design), the primers bind specifically to their complementary sequences on the template strands. During the extension phase at approximately 72°C, Taq polymerase synthesizes new DNA strands by extending from the 3'-OH end of the primers, incorporating dNTPs in the 5' to 3' direction. This three-step cycle is repeated 25-35 times, with each cycle doubling the amount of target DNA, resulting in exponential amplification producing approximately 2^n copies of the target sequence where n is the number of cycles. A thermal cycler instrument automates the temperature changes and timing of each cycle, ensuring precise and rapid cycling. After amplification is complete, the PCR product is typically analyzed by gel electrophoresis to visualize the amplified DNA fragment and confirm successful amplification of the correct target sequence.
  37. 37. Microorganisms produce numerous bioactive molecules with significant medical and industrial applications. Penicillin is produced by the fungus Penicillium notatum or Penicillium chrysogenum and is a beta-lactam antibiotic that inhibits bacterial cell wall synthesis by binding to penicillin-binding proteins and preventing peptidoglycan cross-linking. It is used to treat a wide range of bacterial infections caused by gram-positive and some gram-negative bacteria, making it one of the most important antibiotics in clinical medicine. Cyclosporin A is produced by certain fungi such as Tolypocladium and related Trichoderma species and functions as an immunosuppressive agent by inhibiting T cell activation and cytokine production. It is used clinically to prevent organ transplant rejection and to treat autoimmune diseases. Other important examples include insulin, produced by recombinant Escherichia coli through genetic engineering, which is used to treat diabetes mellitus by regulating blood glucose levels. Statins such as lovastatin, produced by fungi like Monascus and Aspergillus species, are used to lower cholesterol levels and reduce cardiovascular disease risk. Additional examples include human growth hormone produced by recombinant bacteria for treating growth disorders, and various enzymes like amylase and protease produced by microorganisms for industrial applications in food processing and detergent manufacturing.
  38. 38. The following corrections address common misconceptions about assisted reproductive techniques and contraceptive devices. For statement a, ZIFT (Zygote Intrafallopian Transfer) specifically refers to the transfer of a fertilized ovum or zygote into the fallopian tube, not an unfertilized ovum. The transfer of unfertilized ova and sperms together into the fallopian tube is called GIFT (Gamete Intrafallopian Transfer), which is the reverse of what was stated. For statement b, the transfer of an embryo containing more than 8 blastomeres into the uterus is called embryo transfer (ET) or embryo replacement, not GIFT. GIFT involves transfer of gametes, not embryos, and occurs in the fallopian tube, not the uterus. For statement c, Multiload-375 is a copper-releasing intrauterine device (Cu-IUD), not a hormone-releasing IUD. Copper ions released from the device create an environment toxic to sperm and inhibit implantation, whereas hormone-releasing IUDs such as the Levonorgestrel-releasing IUD (LNG-IUD) work by releasing synthetic progesterone to prevent pregnancy. These distinctions are important for understanding the mechanisms and appropriate applications of different reproductive technologies and contraceptive methods.
Brain Grain · braingrain.in
Zoology — Practice Paper · Set 2
Class: 12Samacheer KalviMax Marks: 92
Name: ____________________Reg No: ____________
Part I — Multiple Choice Questions 14 × 1 = 14

Choose the correct answer. (Answer all questions.)

1.It is established that RNA is the first genetic material. Justify giving reasons.[1]
2.What is bioremediation?[1]
3.How does Neanderthal man differ from the modern man in appearance?[1]
4.What are the effects of noise pollution?[1]
5.Explain how recombinant insulin can be produced.[1]
6.Why do you think it is not possible to produce vaccine against 'common cold'?[1]
7.Open Book Assessment: 'Healthy reproduction, legally checked birth control measures and proper family planning programmes are essential for the survival of mankind.' Justify.[1]
8.Write a note on (i) Protected areas and (ii) Wildlife Sanctuaries.[1]
9.Differentiate between the following: (a) External and Internal fertilization (b) Regeneration in lizard and Planaria[1]
10.Tabulate and analysis of two species population interaction.[1]
11.Explain the inheritance of sex linked characters in human being.[1]
12.The following is the illustration of the sequence of ovarian events (a-i) in a human female. a) Identify the figure that illustrates ovulation and mention the stage of oogenesis it represents. b) Name the ovarian hormone and the pituitary hormone that have caused the above-mentioned events. c) Explain the changes that occurs in the uterus simultaneously in anticipation. d) Write the difference between C and H.[1]
13.Explain the different kinds of syngamy in living organisms.[1]
14.In which of the following phyla, the adult shows radial symmetry but the larva shows bilateral symmetry? a. Mollusca b. Echinodermata c. Arthropoda d. Annelida[1]
Part II — Short Answer Questions 14 × 2 = 28

Answer briefly. (Answer all questions.)

15.What is a Habitat?[2]
16.A - Head of the sperm consists of acrosome and mitochondria. R - Acrosome contains spiral rows of mitochondria. Choose correct relation.[2]
17.What is haplodiploidy?[2]
18.What is parthenogenesis? Give two examples from animals.[2]
19.Expand (i) CFC (ii) AQI (iii) PAN[2]
20.Select the correct term from the bracket and complete the given branching tree Birth control methods Condoms, vaults, Caps etc., Pills Vasectomy B Coitus interruptus Periodic abstinence Natural methods A Oral contraceptives Surgical methods IUDs (Barriers, Lactational amenorrhoea, CuT, Tubectomy) 44 Reprod u c t i v e Health 7HPSRUDU\ PHWKRG 3HUPDQHQW 0HWKRG 7XEHFWRP\ 9DVHFWRP\ 3URJHVWDVHUW /1* &X 7 $ 1RYD 7 &X &X7 $J 0XOWLORDG +RUPRQDO EDUULHU 'LDSKUDJP &HUYLFDO FDS 9DXOWV &RQGRP 0HFKDQLFDO EDUULHU %DUULHU PHWKRG &KHPLFDO EDUULHU 3HULRGLF DEVWLQHQFH UK\WKP PHWKRG &RQWLQXRXV DEVWLQHQFH &RLWXV LQWHUUXSWXV /DFWDWLRQDO $PHQRUUKRHD 1DWXUDO PHWKRG 2UDO FRQWUDFHSWLYHV %,57+ &21752/ 0(7+2'6 1RQ PHGLFDWHG ,8'V +RUPRQDO UHOHDVLQJ ,8'V &RSSHU UHOHDVLQJ ,8'V /LSSHV ORRS 0LQL SLOOV 6DKHOL FHQWFKURPDQ )RDPLQJ WDEOHWV PHOWLQJ VXSSRVLWRULHV MHOOLHV DQG FUHDPV ,QWUDXWHULQH 'HYLFHV[2]
21.What is male heterogamety?[2]
22.What are holandric genes?[2]
23.Given below are some human organs. Identify one primary and one secondary lymphoid organ. Explain its role. Liver, thymus, stomach, thyroid, tonsils[2]
24.Brief about female heterogamety.[2]
25.What is Pedogenesis?[2]
26.What is Lyonisation?[2]
27.Mention the symptoms of Phenylketonuria.[2]
28.What is Acclimatisation?[2]
Part III — Long Answer Questions 10 × 5 = 50

Answer in detail. (Answer all questions.)

29.Discuss briefly the following: a. Catalytic converter b. Ecosan toilets[5]
30.Placenta is an endocrine tissue. Justify.[5]
31.Define the following terms: a) Antibiotics b) Zymology c) Superbug[5]
32.PCR is a useful tool for early diagnosis of an Infectious disease. Elaborate.[5]
33.a) Identify the figure given below. b) Redraw the structure as a replicating fork and label the parts (3' 5' 3' 5'). c) Write the source of energy for this replication and name the enzyme involved in this process. d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.[5]
34.A low level of expression of lac operon occurs at all the time. Justify the statement.[5]
35.A person is infected by HIV. How will you diagnose for AIDS?[5]
36.Who disproved Lamarck's Theory of acquired characters? How?[5]
37.From their examination of the structure of DNA, what did Watson and Crick infer about the probable mechanism of DNA replication, coding capability and mutation?[5]
38.How does Mutation theory of De Vries differ from Lamarck and Darwin's view in the origin of new species.[5]
🔑 Show Answer Key — Set 2
  1. 1. RNA is considered the first genetic material because it can both store information and act as a catalyst (ribozyme), can self-replicate under plausible prebiotic conditions, and modern evidence (ribozymes, central role of RNA in translation) supports an RNA world preceding DNA/protein biology.
  2. 2. Bioremediation is an environmental biotechnology approach that uses living organisms, primarily microorganisms such as bacteria and fungi, and plants to degrade, detoxify, or remove pollutants and contaminants from contaminated environments. The process can be implemented through two main strategies: in situ bioremediation, where contamination is treated at the site of pollution without removing the contaminated material, and ex situ bioremediation, where contaminated soil or water is excavated or extracted and treated in a controlled facility away from the original site. Microorganisms employed in bioremediation possess enzymatic capabilities to break down various pollutants including petroleum hydrocarbons from oil spills, pesticides and herbicides, heavy metals through bioaccumulation or biotransformation, and even synthetic polymers like plastics. Bacteria such as Pseudomonas and other genera can metabolize complex organic pollutants as energy sources, converting them into less toxic or non-toxic compounds. Plants can absorb and accumulate heavy metals in their tissues through phytoremediation, or their associated rhizosphere microorganisms can degrade organic contaminants. Bioremediation is advantageous because it is cost-effective, environmentally sustainable, and can be applied to various types of contamination in soil, water, and sediments, making it an important tool in environmental restoration and pollution control.
  3. 3. Neanderthal man (Homo neanderthalensis) differed from modern humans (Homo sapiens) in several significant anatomical features. Neanderthals were more robust and heavily built with a stockier body structure adapted to cold climates, whereas modern humans are more gracile and lightly built. Neanderthals possessed heavy, prominent brow ridges above their eyes, while modern humans have smooth foreheads. The forehead of Neanderthals was low and receding, sloping backward, whereas modern humans have a vertical, prominent forehead. Neanderthals had a large nose, which may have been an adaptation for warming cold air before it entered the lungs, while modern humans have a smaller, more prominent nose. Neanderthals displayed an occipital bun, a projection at the back of the skull, which is absent in modern humans. The mid-face of Neanderthals projected forward, giving them a protruding appearance, whereas modern humans have a more retracted mid-face. Most distinctively, Neanderthals lacked a prominent chin, having a receding chin region, while modern humans possess a well-developed, projecting chin. These anatomical differences reflect different evolutionary pressures and adaptations, with Neanderthals being specialized for cold environments while modern humans show features associated with increased cognitive capacity and refined tool use.
  4. 4. Noise pollution produces a wide range of harmful effects on both human health and wildlife. Auditory effects include hearing loss, which can result from prolonged exposure to loud sounds, and tinnitus, a persistent ringing in the ears that can significantly impact quality of life. Physiological stress responses occur when organisms are exposed to excessive noise, leading to elevated blood pressure, increased heart rate, and elevated levels of stress hormones such as cortisol. These physiological changes can contribute to cardiovascular disease and other stress-related health conditions. Sleep disturbance is a major consequence of noise pollution, as continuous or intermittent loud sounds prevent individuals from achieving adequate rest, which is essential for physical and mental health. Chronic sleep deprivation due to noise exposure can lead to fatigue, reduced cognitive function, and increased susceptibility to illness. Reduced work efficiency and concentration are observed in individuals exposed to noise pollution, as the brain's ability to focus and process information is compromised. Behavioral impacts include increased irritability, anxiety, and aggression in both humans and animals. In wildlife, noise pollution disrupts communication between animals, interferes with mating and feeding behaviors, and can cause animals to abandon their habitats. Marine animals are particularly affected by underwater noise from ships and industrial activities, which disrupts their echolocation and navigation systems. Overall, noise pollution represents a significant environmental stressor with far-reaching consequences for the health and well-being of organisms across ecosystems.
  5. 5. Recombinant insulin is produced through a multi-step biotechnological process that involves genetic engineering and protein expression in microbial hosts. The first step is to identify and isolate the human insulin gene or the genes encoding the individual insulin A and B chains, or alternatively, the proinsulin gene, which encodes a single-chain precursor that is later processed into mature insulin. The isolated insulin gene or cDNA is then inserted into an expression vector, which is a plasmid or viral DNA construct containing regulatory sequences such as promoters and terminators that control gene expression. The recombinant expression vector is introduced into a suitable microbial host cell, most commonly Escherichia coli (E. coli) bacteria or yeast cells such as Saccharomyces cerevisiae, which are chosen for their rapid growth, ease of genetic manipulation, and ability to produce large quantities of recombinant protein. The host cells are cultured in fermentation vessels under controlled conditions of temperature, pH, and nutrient availability to maximize protein expression. The expressed insulin or proinsulin is then harvested from the cultured cells and purified using chromatographic techniques such as gel filtration, ion exchange chromatography, and reverse-phase high-performance liquid chromatography (HPLC) to remove bacterial proteins and other contaminants. If proinsulin was expressed, it must be processed enzymatically or chemically to remove the connecting C-peptide, generating the mature insulin molecule consisting of the A and B chains linked by disulfide bonds. If the A and B chains were expressed separately, they must be chemically or enzymatically linked and refolded to form the correct three-dimensional structure with proper disulfide bond formation. The final purified and properly folded recombinant insulin is then formulated, sterilized, and packaged for pharmaceutical use. This biotechnological approach has revolutionized insulin production, providing a safe, abundant, and cost-effective supply of insulin for the treatment of diabetes mellitus, eliminating the previous dependence on insulin extracted from animal pancreases.
  6. 6. It is not possible to produce an effective vaccine against the common cold due to several interconnected factors related to viral diversity and immune response characteristics. The common cold is caused by more than 100 different virus serotypes, primarily rhinoviruses, but also including coronaviruses, adenoviruses, enteroviruses, and parainfluenza viruses. This extreme antigenic diversity means that immunity to one serotype does not provide protection against others, making a single vaccine impractical. Additionally, these viruses undergo frequent antigenic variation and mutation, allowing them to evade previously acquired immunity. The common cold viruses primarily infect the upper respiratory tract, where mucosal immunity (mediated by secretory IgA antibodies) is the primary defense mechanism. However, mucosal immunity is short-lived and wanes relatively quickly, providing only temporary protection. Furthermore, the economic burden of developing and maintaining vaccines against so many different serotypes would be prohibitive given that the common cold is generally self-limiting and causes minimal mortality. The combination of high viral diversity, rapid antigenic variation, short-lived mucosal immunity, and the mild nature of the disease makes vaccine development against the common cold impractical and economically unfeasible.
  7. 7. Healthy reproduction, legally regulated birth control measures, and proper family planning programmes are essential for mankind's survival for several interconnected reasons. Healthy reproduction ensures that children are born with minimal genetic and developmental abnormalities, reducing infant and child mortality and promoting the birth of healthy individuals who can contribute productively to society. Legally checked birth control measures prevent unsafe and unregulated practices that endanger women's health and lives. Proper family planning programmes enable couples to space pregnancies appropriately, reducing maternal and child health risks associated with frequent pregnancies and allowing adequate recovery time between births. These measures help maintain sustainable population levels that do not exceed the carrying capacity of available resources and environment. When population growth is controlled through planned parenthood, resources such as food, water, education, and healthcare can be distributed more equitably, preventing scarcity and conflict. Environmental degradation caused by overpopulation is minimized, preserving ecosystems and natural resources for future generations. Socioeconomic development is facilitated when families are smaller and resources can be invested in education, healthcare, and economic opportunities rather than being stretched across too many dependents. Women's health, education, and empowerment improve when they have control over their reproductive choices. Collectively, these factors ensure demographic stability, environmental sustainability, and socioeconomic progress, all of which are fundamental requirements for the long-term survival and prosperity of mankind.
  8. 8. Protected areas are designated regions of land or water specifically managed for the conservation of biodiversity, ecosystem services, and genetic resources. They include national parks, wildlife sanctuaries, biosphere reserves, and other conservation designations. Protected areas function as in situ conservation sites where species are protected within their natural habitats and ecological communities are maintained. They serve multiple purposes including preserving representative ecosystems, protecting endangered species, maintaining ecosystem services such as water purification and carbon sequestration, supporting scientific research, and providing educational opportunities. Protected areas are managed according to conservation plans that may restrict human activities to varying degrees depending on the designation and management objectives. Wildlife sanctuaries are a specific category of protected areas where the primary aim is protection of wildlife and their habitats. In sanctuaries, the focus is on preserving animal species and maintaining suitable habitat conditions for their survival and reproduction. Unlike national parks, wildlife sanctuaries may allow certain regulated human activities such as controlled grazing, collection of non-timber forest products, and limited resource use by local communities, provided these activities do not significantly harm wildlife populations. Sanctuaries typically have less stringent restrictions than national parks but stricter protections than unprotected areas. The management of sanctuaries involves monitoring wildlife populations, controlling poaching, managing habitat quality, and balancing conservation needs with the rights and livelihoods of local communities. Both protected areas and wildlife sanctuaries are essential components of biodiversity conservation strategies, functioning as refugia for species and maintaining ecological integrity in increasingly fragmented landscapes.
  9. 9. (a) External fertilization: gametes fuse outside body (aquatic animals, many fishes/amphibians), many small gametes, often large number of offspring and less parental care. Internal fertilization: gametes fuse inside body (terrestrial animals, mammals, birds), fewer gametes, greater parental care. (b) Regeneration: Lizard — limited regeneration (mainly tail) via blastema; replacement is partial and tissue types more restricted. Planaria — extensive regeneration: any small fragment can regenerate whole organism due to abundant pluripotent neoblasts.
  10. 10. Two-species population interactions can be analyzed and tabulated based on the effects on each species, represented by + (positive effect), − (negative effect), or 0 (no effect). Competition (−/−) occurs when both species are negatively affected as they utilize the same limited resources, reducing fitness and survival of both. Predation and parasitism (+/−) involve one species (predator or parasite) benefiting while the other (prey or host) is harmed; the predator gains nutrition while the prey population decreases. Mutualism (+/+) is a mutually beneficial interaction where both species gain advantages, such as flowering plants and their pollinators or nitrogen-fixing bacteria and legumes. Commensalism (+/0) benefits one species while the other is unaffected, as seen when epiphytic plants grow on trees without harming them. Amensalism (−/0) harms one species while leaving the other unaffected, such as when antibiotic-producing microorganisms inhibit competitors. Neutralism (0/0) occurs when two species coexist with no effect on each other. These interactions shape community structure, influence species distribution and abundance, and drive ecological succession and evolution. Understanding these interactions is essential for predicting ecosystem responses to environmental changes and managing biodiversity.
  11. 11. Sex-linked characters in humans are traits controlled by genes located on the sex chromosomes, primarily the X chromosome. Since males have only one X chromosome (XY), they express both dominant and recessive alleles on the X chromosome, making them hemizygous. Females have two X chromosomes (XX), so they can be homozygous or heterozygous for X-linked traits. For X-linked recessive traits like color blindness and hemophilia, affected males have the genotype X^a Y where X^a represents the recessive allele. Carrier females have the genotype X^A X^a (one normal and one mutant allele) and typically show the dominant phenotype but can pass the recessive allele to offspring. When a carrier female (X^A X^a) mates with a normal male (X^A Y), the offspring show a 1:1 ratio in males (half normal X^A Y and half affected X^a Y) and all females are normal phenotypically (half X^A X^A and half X^A X^a carriers). When an affected female (X^a X^a) mates with a normal male (X^A Y), all daughters are carriers (X^A X^a) and all sons are affected (X^a Y). This criss-cross inheritance pattern explains why X-linked recessive traits appear more frequently in males than females. The inheritance of X-linked dominant traits differs because affected heterozygous females (X^A X^a) pass the dominant allele to half their offspring of both sexes, while affected males (X^A Y) pass the dominant allele to all daughters but no sons.
  12. 12. a) The figure showing the ruptured mature (Graafian) follicle illustrates ovulation; it represents release of a secondary oocyte arrested in metaphase II. b) Ovarian hormone: estrogen (produced by the mature follicle); Pituitary hormone: LH (luteinizing hormone surge). c) Uterine changes: endometrium moves from proliferative to secretory phase under progesterone (after corpus luteum forms): becomes thicker, more glandular and vascularized; glands secrete nutrient-rich fluid preparing for implantation. d) Difference between C and H (assumed C = corpus luteum; H = corpus albicans): corpus luteum is yellow, functional, secretes progesterone and some estrogen; corpus albicans is a pale fibrous scar (degenerate corpus luteum), non-functional and hormone-inactive.
  13. 13. Syngamy refers to the fusion of two gametes to form a zygote, and different types of syngamy are classified based on the morphology and motility of the fusing gametes. Isogamy is the fusion of two morphologically similar and equally motile gametes, as seen in many algae and fungi where both gametes appear identical. Anisogamy involves the fusion of two gametes that differ in size and morphology, where one gamete is larger and less motile than the other, observed in certain algae and protozoans. Oogamy is the fusion of a large, non-motile female gamete (ovum) with a small, motile male gamete (sperm), which is the most common type of syngamy in higher animals and plants. These different types of syngamy reflect variations in sexual reproduction strategies across different organisms.
  14. 14. b) Echinodermata Explanation: Echinoderm adults (e.g., sea stars, sea urchins) display radial (usually pentaradial) symmetry, whereas their larvae (for example, bipinnaria or pluteus larvae) are bilaterally symmetrical. This change reflects their planktonic larval stage and sedentary/adult body plan.
  15. 15. A habitat is the specific place or physical environment where an organism or a population normally lives, survives, and reproduces. It encompasses the particular location and all the biotic and abiotic factors present in that location that the organism requires for its survival and growth. For example, a pond serves as the habitat for a frog, providing water, aquatic vegetation, insects for food, and appropriate temperature conditions. An oak tree is the habitat for a woodpecker, offering shelter in cavities, insects for food, and suitable nesting sites. Different organisms have different habitat requirements based on their physiological needs, feeding habits, and behavioral patterns. A habitat is distinct from a niche, which refers not only to the place where an organism lives but also to the specific role and function of that organism within its environment. The quality and availability of suitable habitats are critical factors determining the distribution, abundance, and survival of species in nature.
  16. 16. Both A and R are false
  17. 17. In haplodiploidy, the sex of the offspring is determined by the number of sets of chromosomes it receives. Fertilized eggs develop into females (Queen or Worker) and unfertilized eggs develop into males (drones) by parthenogenesis. It means that the males have half the number of chromosomes (haploid) and the females have double the number (diploid).
  18. 18. Parthenogenesis is the development of an embryo from an unfertilized egg without the fusion of male and female gametes. It is a form of asexual reproduction where the haploid egg undergoes mitotic divisions to produce a diploid organism. Examples of parthenogenesis in animals include drones (male bees) of the honey bee (Apis), where males develop from unfertilized eggs, certain aphids that reproduce parthenogenetically during favorable seasons, and some whiptail lizards (genus Aspidoscelis) where certain species reproduce entirely through parthenogenesis without males.
  19. 19. CFC = Chlorofluorocarbon; AQI = Air Quality Index; PAN = Peroxyacetyl nitrate (Peroxyacyl nitrates).
  20. 20. A — Barriers (e.g., condoms, caps, vaults) B — Lactational amenorrhoea (natural method) C — CuT (IUD) D — Tubectomy (surgical method)
  21. 21. Male heterogamety refers to the condition where males produce two different types of gametes (sperm cells) during meiosis. In mammals including humans, males have XY sex chromosomes, so they produce two types of sperm: some carrying the X chromosome and some carrying the Y chromosome. When a sperm carrying the X chromosome fertilizes an egg (which always carries an X chromosome), the resulting offspring is female (XX). When a sperm carrying the Y chromosome fertilizes an egg, the resulting offspring is male (XY). Thus, males are the heterogametic sex because they determine the sex of the offspring through their gamete contribution.
  22. 22. Holandric genes are genes present in the differential region of the Y chromosome that have no corresponding alleles on the X chromosome. These genes are found only on the Y chromosome and are therefore exclusive to males. Holandric genes are also called Y-linked genes. Since males have only one Y chromosome and females have none, holandric genes are transmitted directly from father to son and appear in every male descendant of an affected male. These genes do not show the typical criss-cross inheritance pattern seen with X-linked genes. Examples of holandric genes include those controlling male sex determination and spermatogenesis. The inheritance of holandric genes is strictly patrilineal, with the trait appearing in all male offspring of an affected father but never in female offspring or in any descendants through females.
  23. 23. From the given organs, thymus is a primary lymphoid organ and tonsils are a secondary lymphoid organ. The thymus is a primary lymphoid organ located in the chest behind the breastbone where T lymphocytes (T cells) develop and mature. In the thymus, immature T cells undergo selection processes that ensure they can recognize self-antigens appropriately while eliminating those that would attack the body's own cells, thus achieving immunocompetency. The thymus is particularly active during childhood and gradually decreases in size and function with age. Tonsils are secondary lymphoid organs located in the pharynx (throat region) that help defend against pathogens entering through the mouth and respiratory tract. Tonsils contain lymphoid tissue and are populated with B and T lymphocytes that work together to fight viral and bacterial infections. When pathogens are encountered, tonsils produce antibodies and activate immune responses to neutralize and eliminate these invading microorganisms, providing a first line of defense against respiratory and gastrointestinal infections.
  24. 24. Female heterogamety (ZO females) refers to the condition where female produces two types of egg cells. Some with Z chromosome and some without Z chromosome. This pattern occurs in birds, butterflies, and some other organisms where females have ZO sex chromosomes (one Z and no second sex chromosome) while males have ZZ chromosomes. During meiosis in females, the Z chromosome segregates into some eggs while other eggs receive no sex chromosome (O). When a Z-bearing egg is fertilized by a Z-bearing sperm from the male, the offspring is female (ZO). When an O-bearing egg is fertilized by a Z-bearing sperm, the offspring is male (ZZ). Thus, in this system, females are heterogametic and determine the sex of offspring.
  25. 25. Pedogenesis is the process of soil formation from parent rock through physical, chemical and biological weathering combined with the accumulation of organic matter. Physical weathering involves the mechanical breakdown of rock by temperature fluctuations, frost action, and water erosion. Chemical weathering occurs through oxidation, hydrolysis, and dissolution of minerals by water and acids. Biological weathering is facilitated by plant roots, lichens, fungi, and soil microorganisms that break down rock and contribute organic material. Over time, these processes create distinct soil horizons, with the uppermost layers becoming enriched with humus and developing the characteristics necessary to support plant life. Pedogenesis is a slow process, typically requiring centuries to millennia to produce mature, fertile soil.
  26. 26. Lyonisation is the process of inactivation or silencing of one of the two X chromosomes in female mammals. In female cells, one X chromosome is randomly selected and becomes highly condensed into a structure called a Barr body, rendering most of its genes transcriptionally inactive. This process occurs early in female development and is random, meaning that in some cells the maternal X chromosome is inactivated while in other cells the paternal X chromosome is inactivated. Lyonisation ensures dosage compensation, equalizing X-linked gene expression between males (who have one X chromosome) and females (who have two X chromosomes). This prevents females from having a double dose of X-linked gene products. The inactivated X chromosome remains condensed and transcriptionally silent throughout the life of the cell and is passed to daughter cells during cell division, maintaining the same pattern of X inactivation in clonal cell populations.
  27. 27. Phenylketonuria (PKU) is an autosomal recessive metabolic disorder caused by deficiency of the enzyme phenylalanine hydroxylase, which normally converts the amino acid phenylalanine to tyrosine. The primary symptoms include severe mental retardation or intellectual disability if the condition is not detected and treated early in life. Affected individuals typically have light pigmentation of the skin and hair due to reduced melanin synthesis, as tyrosine is a precursor for melanin. A characteristic musty or mousy odour is often present in the body odour and urine of affected individuals. Phenylpyruvic acid, a metabolite of phenylalanine, accumulates and is excreted in the urine. Early diagnosis through newborn screening and implementation of a phenylalanine-restricted diet can prevent the neurological damage and intellectual disability associated with this condition, making early detection and dietary management crucial for affected individuals.
  28. 28. Acclimatisation is the reversible physiological, morphological or behavioural adjustment of an individual organism to changes in its environment. These adjustments occur within the lifetime of an organism and allow it to cope with environmental stress or variation. A classic example is the increase in red blood cell production in humans at high altitude, which enhances oxygen-carrying capacity in response to lower atmospheric oxygen. Other examples include thickening of skin in response to cold, changes in enzyme activity to match temperature fluctuations, and behavioral modifications such as altered feeding patterns or activity timing. Unlike adaptation, which is a genetic change occurring over generations, acclimatisation is reversible and does not involve changes to the organism's genetic makeup.
  29. 29. A catalytic converter is an automobile exhaust emission control device that reduces harmful pollutants in vehicle exhaust gases before they are released into the atmosphere. The device contains a ceramic or metallic substrate coated with catalytic materials including platinum, palladium, and rhodium. As exhaust gases pass through the converter, these catalysts facilitate chemical reactions that convert harmful pollutants into less harmful substances. Carbon monoxide, a toxic gas produced from incomplete combustion of fuel, is oxidized to carbon dioxide. Hydrocarbons, which are unburned fuel vapors that contribute to smog formation, are oxidized to carbon dioxide and water. Nitrogen oxides, which are produced at high combustion temperatures and contribute to smog and acid rain, are reduced to nitrogen gas and oxygen. Through these catalytic reactions, the converter significantly reduces emissions of three major air pollutants, making it essential for meeting emission standards and reducing vehicular air pollution. Catalytic converters have been mandatory equipment on vehicles in many countries for decades and have substantially improved urban air quality. Ecosan toilets, or ecological sanitation toilets, are alternative sanitation systems designed to minimize environmental impact and recover nutrients from human waste. These toilets separate urine and feces at the point of generation, preventing their mixing and allowing separate treatment and reuse. Ecosan toilets minimize water use compared to conventional flush toilets, which is particularly important in water-scarce regions. The separation of urine and feces reduces pathogen transmission because urine is relatively sterile while feces contain most pathogens. Feces can be composted through aerobic decomposition, producing a nutrient-rich compost suitable for soil amendment after appropriate treatment and storage periods that ensure pathogen inactivation. Urine can be used directly as a nitrogen-rich fertilizer after dilution, or stored for pathogen inactivation. This nutrient recovery allows safe reuse of human waste products as fertilizer, closing nutrient cycles and reducing dependence on synthetic fertilizers. Ecosan toilets reduce the burden on sewage treatment infrastructure and are particularly valuable in areas lacking centralized sewage systems. They promote sustainable resource management and reduce environmental pollution from untreated human waste.
  30. 30. The placenta is classified as an endocrine tissue because it synthesizes and secretes multiple hormones that regulate pregnancy and fetal development. The placenta produces human chorionic gonadotropin (hCG), which maintains the corpus luteum during early pregnancy and prevents menstruation. It also secretes progesterone, which maintains the uterine lining and prevents uterine contractions. Estrogens produced by the placenta promote uterine growth and prepare the mammary glands for lactation. Human placental lactogen (hPL) is secreted to regulate maternal metabolism and ensure adequate nutrient supply to the fetus. Additionally, the placenta produces relaxin, which softens the pelvic ligaments and cervix to facilitate childbirth. Through the coordinated secretion of these hormones, the placenta functions as a true endocrine organ, regulating both maternal physiology and fetal development throughout pregnancy.
  31. 31. a) Antibiotics are chemical substances that are either naturally produced by microorganisms such as bacteria and fungi or synthetically derived through chemical synthesis. These compounds possess the ability to kill or inhibit the growth of other microorganisms, particularly bacteria, by targeting essential cellular structures or metabolic processes. Antibiotics work through various mechanisms including inhibition of cell wall synthesis, disruption of protein synthesis, interference with nucleic acid replication, or disruption of metabolic pathways. They are widely used in clinical medicine to treat bacterial infections and have revolutionized healthcare by reducing mortality from infectious diseases. b) Zymology is the branch of microbiology and biochemistry that studies fermentation processes and the microorganisms and enzymes involved in these processes. It encompasses the study of how microorganisms metabolize substrates in the absence of oxygen, the biochemical pathways involved, and the practical applications of fermentation in food production, beverage manufacturing, and industrial biotechnology. Zymology includes the study of yeast fermentation in brewing and winemaking, lactic acid fermentation in dairy products, and various other fermentation processes. c) A superbug is a microbial strain, usually a bacterium, that has developed resistance to multiple classes of antibiotics, making it extremely difficult or impossible to treat with conventional antimicrobial therapy. Superbugs arise through genetic mutations that alter antibiotic targets or produce enzymes that inactivate antibiotics, and through horizontal gene transfer of resistance genes between bacterial species. Common examples include methicillin-resistant Staphylococcus aureus (MRSA) and multidrug-resistant Mycobacterium tuberculosis. The emergence of superbugs poses a serious public health threat and has led to increased research into alternative antimicrobial strategies and the development of new antibiotics.
  32. 32. PCR (polymerase chain reaction) is an invaluable molecular tool for the early diagnosis of infectious diseases because it enables rapid and highly sensitive detection of pathogen-specific nucleic acid sequences from clinical samples. The principle underlying PCR-based diagnosis is that even when the pathogen load in a patient's sample is extremely low, PCR can amplify specific DNA or RNA sequences of the pathogen exponentially through repeated cycles of denaturation, primer annealing, and DNA synthesis, producing millions of copies of the target sequence that can be easily detected. This high sensitivity allows detection of pathogens at very early stages of infection, often before symptoms appear or before conventional diagnostic methods such as culture or serology become positive. Reverse transcription PCR (RT-PCR) extends the utility of PCR to RNA viruses such as influenza, coronavirus, and HIV by first converting viral RNA to complementary DNA (cDNA) before amplification. Real-time PCR or quantitative PCR (qPCR) further enhances diagnostic capability by monitoring the accumulation of PCR products in real-time during the amplification process, allowing not only detection but also quantification of pathogen load, which is valuable for assessing disease severity and monitoring treatment response. The speed of PCR-based diagnosis is another major advantage; results can be obtained within hours compared to days or weeks required for culture-based methods. Additionally, PCR can be designed to detect multiple pathogens simultaneously (multiplex PCR) and can distinguish between different strains or variants of a pathogen. These characteristics make PCR an essential tool in clinical microbiology laboratories for early, accurate, and rapid diagnosis of infectious diseases, enabling prompt initiation of appropriate treatment and infection control measures.
  33. 33. a) The figure represents antiparallel DNA strands at a replication site (replication fork). b) Key labels for a replication fork: replication fork, leading strand (synthesized continuously 5'→3'), lagging strand (synthesized as Okazaki fragments 5'→3'), RNA primer, DNA polymerase, helicase, ligase, primase, single‑stranded binding proteins, parental (template) strands with 3' and 5' ends. c) Energy: incoming deoxynucleoside triphosphates (dNTPs); enzyme: DNA polymerase (DNA‑dependent DNA polymerase). d) Because DNA strands are antiparallel, transcription/translation proceed with mRNA synthesized 5'→3' using the 3'→5' template; genes on opposite strands are transcribed in opposite directions, so protein synthesis initiation sites and reading frames differ depending on which strand is the template.
  34. 34. A low level of expression of the lac operon occurs at all times because the interaction between the lac repressor protein and the operator is dynamic and not absolute. Although the repressor protein binds to the operator in the absence of lactose and blocks transcription, this binding is not permanent or complete. The repressor protein occasionally dissociates from the operator due to thermal fluctuations and molecular dynamics, allowing RNA polymerase to briefly access the promoter and transcribe the structural genes. Additionally, the repression is not 100 percent efficient, resulting in incomplete repression and allowing some basal or leaky transcription of the lac operon even when lactose is absent. This basal level of enzyme production is actually beneficial because it ensures that some β-galactosidase, permease, and transacetylase are present in the cell, allowing the cell to respond quickly when lactose becomes available by inducing rapid synthesis of these enzymes.
  35. 35. Diagnosis of AIDS in an HIV-infected person involves a systematic approach combining serological, molecular, and clinical assessments. Initial screening is performed using HIV antibody/antigen tests such as rapid tests or enzyme-linked immunosorbent assay (ELISA), which detect HIV-specific antibodies or antigens in blood or saliva. Positive screening results must be confirmed using more specific tests such as Western blot, which detects HIV proteins, or HIV RNA polymerase chain reaction (PCR), which directly detects viral genetic material and is the gold standard for confirmation. Once HIV infection is confirmed, the progression to AIDS is determined by measuring CD4+ T cell count, which reflects immune system damage. AIDS is diagnosed when the CD4+ T cell count falls below 200 cells per microliter of blood (or below 14 percent of total lymphocytes), indicating severe immunosuppression. Additionally, AIDS diagnosis is made when specific opportunistic infections occur, such as Pneumocystis jirovecii pneumonia, tuberculosis, toxoplasmosis, cytomegalovirus infection, or cryptococcal meningitis, or when clinical criteria such as wasting syndrome or HIV-associated dementia are present. Regular monitoring of CD4 count and viral load helps assess disease progression and guide antiretroviral therapy.
  36. 36. August Weismann disproved Lamarck's theory of acquired characters through his germ-plasm theory and experimental evidence. Weismann proposed that inheritance is controlled by the germ-plasm (germ cells), which is separate from the soma (body cells). He argued that changes acquired by the body during an organism's lifetime cannot be transmitted to offspring because they do not affect the germ-plasm. To test this hypothesis, Weismann conducted experiments in which he cut off the tails of mice for many successive generations and observed their offspring. Despite this repeated mutilation over numerous generations, the offspring continued to be born with normal tails, demonstrating that acquired characteristics are not inherited. This experiment provided strong evidence against Lamarck's theory and supported the principle that only changes in the genetic material can be passed to the next generation. Weismann's work established the fundamental distinction between somatic mutations (which affect only the individual) and germline mutations (which can be inherited), laying the groundwork for modern understanding of heredity and evolution.
  37. 37. Watson and Crick inferred three fundamental mechanisms from DNA structure. First, they proposed that DNA replication is semi-conservative, occurring through complementary base pairing where each strand of the double helix serves as a template for a new strand, ensuring accurate copying of genetic information. Second, they recognized that the genetic information is encoded in the linear sequence of bases along the DNA molecule, with the specific order of adenine, thymine, guanine, and cytosine determining the genetic code and providing the coding capability for all hereditary traits. Third, they understood that mutations arise from changes or alterations in the base sequence of DNA, and these changes in the genetic code can alter the genetic information and be inherited by offspring, explaining how genetic variation occurs and is transmitted through generations.
  38. 38. De Vries' Mutation theory differs fundamentally from both Lamarck's and Darwin's theories in explaining the origin of new species. Lamarck proposed that new species arise through the inheritance of acquired characters, where traits developed through use or disuse during an organism's lifetime are passed to offspring. Darwin proposed that new species arise through the gradual accumulation of small heritable variations over long periods, with natural selection acting on this continuous variation to favor advantageous traits. In contrast, De Vries' Mutation theory, also called saltationism, proposed that new species arise suddenly through large, discontinuous heritable mutations rather than through gradual change. De Vries observed sudden, large variations in evening primrose plants and concluded that these mutations could directly produce new species in a single generation or a few generations, without requiring the long periods of gradual selection that Darwin envisioned. While De Vries correctly identified mutations as a source of variation, his theory overestimated the role of large mutations and underestimated the importance of natural selection and gradual change. Modern evolutionary synthesis has integrated these views, recognizing that mutations provide the raw material for variation, but natural selection acting on this variation over time is the primary driver of evolutionary change and speciation.
Brain Grain · braingrain.in
Zoology — Practice Paper · Set 3
Class: 12Samacheer KalviMax Marks: 92
Name: ____________________Reg No: ____________
Part I — Multiple Choice Questions 14 × 1 = 14

Choose the correct answer. (Answer all questions.)

1.What is bioremediation?[1]
2.How does Neanderthal man differ from the modern man in appearance?[1]
3.What are the effects of noise pollution?[1]
4.Explain how recombinant insulin can be produced.[1]
5.Why do you think it is not possible to produce vaccine against 'common cold'?[1]
6.Open Book Assessment: 'Healthy reproduction, legally checked birth control measures and proper family planning programmes are essential for the survival of mankind.' Justify.[1]
7.Write a note on (i) Protected areas and (ii) Wildlife Sanctuaries.[1]
8.Differentiate between the following: (a) External and Internal fertilization (b) Regeneration in lizard and Planaria[1]
9.Tabulate and analysis of two species population interaction.[1]
10.Explain the inheritance of sex linked characters in human being.[1]
11.The following is the illustration of the sequence of ovarian events (a-i) in a human female. a) Identify the figure that illustrates ovulation and mention the stage of oogenesis it represents. b) Name the ovarian hormone and the pituitary hormone that have caused the above-mentioned events. c) Explain the changes that occurs in the uterus simultaneously in anticipation. d) Write the difference between C and H.[1]
12.Explain the different kinds of syngamy in living organisms.[1]
13.In which of the following phyla, the adult shows radial symmetry but the larva shows bilateral symmetry? a. Mollusca b. Echinodermata c. Arthropoda d. Annelida[1]
14.It is established that RNA is the first genetic material. Justify giving reasons.[1]
Part II — Short Answer Questions 14 × 2 = 28

Answer briefly. (Answer all questions.)

15.A - Ovulation is the release of ovum from the Graafian follicle. R - It occurs during the follicular phase of the menstrual cycle. Choose correct relation.[2]
16.Name the phenomenon where the female gamete directly develops into a new organism with an avian example.[2]
17.What is criss-cross inheritance?[2]
18.Differentiate between Eurytherms and Stenotherms.[2]
19.Expand the following a) ZIFT b) ICSI[2]
20.If the coding sequence in a transcription unit is written as follows: 5' TGCATGCATGCATGCATGCATGCATGC 3' Write down the sequence of mRNA.[2]
21.A - In human male, testes are extra abdominal and lie in scrotal sacs. R - Scrotum acts as thermoregulator and keeps temperature lower by 2°C for normal sperm production. Choose correct relation.[2]
22.Name an organism where cell division is itself a mode of reproduction.[2]
23.List out the major gases seems to be found in the primitive earth.[2]
24.Mention the symptoms of Down's syndrome.[2]
25.A patient was hospitalized with fever and chills. Merozoites were observed in her blood. What is your diagnosis?[2]
26.How is sex determined in human beings?[2]
27.What is soil permeability?[2]
28.Why is the offspring formed by asexual reproduction referred as a clone?[2]
Part III — Long Answer Questions 10 × 5 = 50

Answer in detail. (Answer all questions.)

29.Explain why cloning of Dolly, the sheep was such a major scientific breakthrough?[5]
30.Write the preventive measures of STDs.[5]
31.Define gametogenesis.[5]
32.Classify the adaptive traits found in organisms.[5]
33.Differentiate between divergent evolution and convergent evolution with one example for each.[5]
34.Autoimmunity is a misdirected immune response. Justify.[5]
35.When does antibiotic resistance develop?[5]
36.What are the factors that drive habitat loss?[5]
37.What is Red data book? Mention it purposes.[5]
38.List all the wastes that you generate, at home, school or during your trips to other places. Could you very easily reduce the generation of these wastes? Which would be difficult or rather impossible to reduce?[5]
🔑 Show Answer Key — Set 3
  1. 1. Bioremediation is an environmental biotechnology approach that uses living organisms, primarily microorganisms such as bacteria and fungi, and plants to degrade, detoxify, or remove pollutants and contaminants from contaminated environments. The process can be implemented through two main strategies: in situ bioremediation, where contamination is treated at the site of pollution without removing the contaminated material, and ex situ bioremediation, where contaminated soil or water is excavated or extracted and treated in a controlled facility away from the original site. Microorganisms employed in bioremediation possess enzymatic capabilities to break down various pollutants including petroleum hydrocarbons from oil spills, pesticides and herbicides, heavy metals through bioaccumulation or biotransformation, and even synthetic polymers like plastics. Bacteria such as Pseudomonas and other genera can metabolize complex organic pollutants as energy sources, converting them into less toxic or non-toxic compounds. Plants can absorb and accumulate heavy metals in their tissues through phytoremediation, or their associated rhizosphere microorganisms can degrade organic contaminants. Bioremediation is advantageous because it is cost-effective, environmentally sustainable, and can be applied to various types of contamination in soil, water, and sediments, making it an important tool in environmental restoration and pollution control.
  2. 2. Neanderthal man (Homo neanderthalensis) differed from modern humans (Homo sapiens) in several significant anatomical features. Neanderthals were more robust and heavily built with a stockier body structure adapted to cold climates, whereas modern humans are more gracile and lightly built. Neanderthals possessed heavy, prominent brow ridges above their eyes, while modern humans have smooth foreheads. The forehead of Neanderthals was low and receding, sloping backward, whereas modern humans have a vertical, prominent forehead. Neanderthals had a large nose, which may have been an adaptation for warming cold air before it entered the lungs, while modern humans have a smaller, more prominent nose. Neanderthals displayed an occipital bun, a projection at the back of the skull, which is absent in modern humans. The mid-face of Neanderthals projected forward, giving them a protruding appearance, whereas modern humans have a more retracted mid-face. Most distinctively, Neanderthals lacked a prominent chin, having a receding chin region, while modern humans possess a well-developed, projecting chin. These anatomical differences reflect different evolutionary pressures and adaptations, with Neanderthals being specialized for cold environments while modern humans show features associated with increased cognitive capacity and refined tool use.
  3. 3. Noise pollution produces a wide range of harmful effects on both human health and wildlife. Auditory effects include hearing loss, which can result from prolonged exposure to loud sounds, and tinnitus, a persistent ringing in the ears that can significantly impact quality of life. Physiological stress responses occur when organisms are exposed to excessive noise, leading to elevated blood pressure, increased heart rate, and elevated levels of stress hormones such as cortisol. These physiological changes can contribute to cardiovascular disease and other stress-related health conditions. Sleep disturbance is a major consequence of noise pollution, as continuous or intermittent loud sounds prevent individuals from achieving adequate rest, which is essential for physical and mental health. Chronic sleep deprivation due to noise exposure can lead to fatigue, reduced cognitive function, and increased susceptibility to illness. Reduced work efficiency and concentration are observed in individuals exposed to noise pollution, as the brain's ability to focus and process information is compromised. Behavioral impacts include increased irritability, anxiety, and aggression in both humans and animals. In wildlife, noise pollution disrupts communication between animals, interferes with mating and feeding behaviors, and can cause animals to abandon their habitats. Marine animals are particularly affected by underwater noise from ships and industrial activities, which disrupts their echolocation and navigation systems. Overall, noise pollution represents a significant environmental stressor with far-reaching consequences for the health and well-being of organisms across ecosystems.
  4. 4. Recombinant insulin is produced through a multi-step biotechnological process that involves genetic engineering and protein expression in microbial hosts. The first step is to identify and isolate the human insulin gene or the genes encoding the individual insulin A and B chains, or alternatively, the proinsulin gene, which encodes a single-chain precursor that is later processed into mature insulin. The isolated insulin gene or cDNA is then inserted into an expression vector, which is a plasmid or viral DNA construct containing regulatory sequences such as promoters and terminators that control gene expression. The recombinant expression vector is introduced into a suitable microbial host cell, most commonly Escherichia coli (E. coli) bacteria or yeast cells such as Saccharomyces cerevisiae, which are chosen for their rapid growth, ease of genetic manipulation, and ability to produce large quantities of recombinant protein. The host cells are cultured in fermentation vessels under controlled conditions of temperature, pH, and nutrient availability to maximize protein expression. The expressed insulin or proinsulin is then harvested from the cultured cells and purified using chromatographic techniques such as gel filtration, ion exchange chromatography, and reverse-phase high-performance liquid chromatography (HPLC) to remove bacterial proteins and other contaminants. If proinsulin was expressed, it must be processed enzymatically or chemically to remove the connecting C-peptide, generating the mature insulin molecule consisting of the A and B chains linked by disulfide bonds. If the A and B chains were expressed separately, they must be chemically or enzymatically linked and refolded to form the correct three-dimensional structure with proper disulfide bond formation. The final purified and properly folded recombinant insulin is then formulated, sterilized, and packaged for pharmaceutical use. This biotechnological approach has revolutionized insulin production, providing a safe, abundant, and cost-effective supply of insulin for the treatment of diabetes mellitus, eliminating the previous dependence on insulin extracted from animal pancreases.
  5. 5. It is not possible to produce an effective vaccine against the common cold due to several interconnected factors related to viral diversity and immune response characteristics. The common cold is caused by more than 100 different virus serotypes, primarily rhinoviruses, but also including coronaviruses, adenoviruses, enteroviruses, and parainfluenza viruses. This extreme antigenic diversity means that immunity to one serotype does not provide protection against others, making a single vaccine impractical. Additionally, these viruses undergo frequent antigenic variation and mutation, allowing them to evade previously acquired immunity. The common cold viruses primarily infect the upper respiratory tract, where mucosal immunity (mediated by secretory IgA antibodies) is the primary defense mechanism. However, mucosal immunity is short-lived and wanes relatively quickly, providing only temporary protection. Furthermore, the economic burden of developing and maintaining vaccines against so many different serotypes would be prohibitive given that the common cold is generally self-limiting and causes minimal mortality. The combination of high viral diversity, rapid antigenic variation, short-lived mucosal immunity, and the mild nature of the disease makes vaccine development against the common cold impractical and economically unfeasible.
  6. 6. Healthy reproduction, legally regulated birth control measures, and proper family planning programmes are essential for mankind's survival for several interconnected reasons. Healthy reproduction ensures that children are born with minimal genetic and developmental abnormalities, reducing infant and child mortality and promoting the birth of healthy individuals who can contribute productively to society. Legally checked birth control measures prevent unsafe and unregulated practices that endanger women's health and lives. Proper family planning programmes enable couples to space pregnancies appropriately, reducing maternal and child health risks associated with frequent pregnancies and allowing adequate recovery time between births. These measures help maintain sustainable population levels that do not exceed the carrying capacity of available resources and environment. When population growth is controlled through planned parenthood, resources such as food, water, education, and healthcare can be distributed more equitably, preventing scarcity and conflict. Environmental degradation caused by overpopulation is minimized, preserving ecosystems and natural resources for future generations. Socioeconomic development is facilitated when families are smaller and resources can be invested in education, healthcare, and economic opportunities rather than being stretched across too many dependents. Women's health, education, and empowerment improve when they have control over their reproductive choices. Collectively, these factors ensure demographic stability, environmental sustainability, and socioeconomic progress, all of which are fundamental requirements for the long-term survival and prosperity of mankind.
  7. 7. Protected areas are designated regions of land or water specifically managed for the conservation of biodiversity, ecosystem services, and genetic resources. They include national parks, wildlife sanctuaries, biosphere reserves, and other conservation designations. Protected areas function as in situ conservation sites where species are protected within their natural habitats and ecological communities are maintained. They serve multiple purposes including preserving representative ecosystems, protecting endangered species, maintaining ecosystem services such as water purification and carbon sequestration, supporting scientific research, and providing educational opportunities. Protected areas are managed according to conservation plans that may restrict human activities to varying degrees depending on the designation and management objectives. Wildlife sanctuaries are a specific category of protected areas where the primary aim is protection of wildlife and their habitats. In sanctuaries, the focus is on preserving animal species and maintaining suitable habitat conditions for their survival and reproduction. Unlike national parks, wildlife sanctuaries may allow certain regulated human activities such as controlled grazing, collection of non-timber forest products, and limited resource use by local communities, provided these activities do not significantly harm wildlife populations. Sanctuaries typically have less stringent restrictions than national parks but stricter protections than unprotected areas. The management of sanctuaries involves monitoring wildlife populations, controlling poaching, managing habitat quality, and balancing conservation needs with the rights and livelihoods of local communities. Both protected areas and wildlife sanctuaries are essential components of biodiversity conservation strategies, functioning as refugia for species and maintaining ecological integrity in increasingly fragmented landscapes.
  8. 8. (a) External fertilization: gametes fuse outside body (aquatic animals, many fishes/amphibians), many small gametes, often large number of offspring and less parental care. Internal fertilization: gametes fuse inside body (terrestrial animals, mammals, birds), fewer gametes, greater parental care. (b) Regeneration: Lizard — limited regeneration (mainly tail) via blastema; replacement is partial and tissue types more restricted. Planaria — extensive regeneration: any small fragment can regenerate whole organism due to abundant pluripotent neoblasts.
  9. 9. Two-species population interactions can be analyzed and tabulated based on the effects on each species, represented by + (positive effect), − (negative effect), or 0 (no effect). Competition (−/−) occurs when both species are negatively affected as they utilize the same limited resources, reducing fitness and survival of both. Predation and parasitism (+/−) involve one species (predator or parasite) benefiting while the other (prey or host) is harmed; the predator gains nutrition while the prey population decreases. Mutualism (+/+) is a mutually beneficial interaction where both species gain advantages, such as flowering plants and their pollinators or nitrogen-fixing bacteria and legumes. Commensalism (+/0) benefits one species while the other is unaffected, as seen when epiphytic plants grow on trees without harming them. Amensalism (−/0) harms one species while leaving the other unaffected, such as when antibiotic-producing microorganisms inhibit competitors. Neutralism (0/0) occurs when two species coexist with no effect on each other. These interactions shape community structure, influence species distribution and abundance, and drive ecological succession and evolution. Understanding these interactions is essential for predicting ecosystem responses to environmental changes and managing biodiversity.
  10. 10. Sex-linked characters in humans are traits controlled by genes located on the sex chromosomes, primarily the X chromosome. Since males have only one X chromosome (XY), they express both dominant and recessive alleles on the X chromosome, making them hemizygous. Females have two X chromosomes (XX), so they can be homozygous or heterozygous for X-linked traits. For X-linked recessive traits like color blindness and hemophilia, affected males have the genotype X^a Y where X^a represents the recessive allele. Carrier females have the genotype X^A X^a (one normal and one mutant allele) and typically show the dominant phenotype but can pass the recessive allele to offspring. When a carrier female (X^A X^a) mates with a normal male (X^A Y), the offspring show a 1:1 ratio in males (half normal X^A Y and half affected X^a Y) and all females are normal phenotypically (half X^A X^A and half X^A X^a carriers). When an affected female (X^a X^a) mates with a normal male (X^A Y), all daughters are carriers (X^A X^a) and all sons are affected (X^a Y). This criss-cross inheritance pattern explains why X-linked recessive traits appear more frequently in males than females. The inheritance of X-linked dominant traits differs because affected heterozygous females (X^A X^a) pass the dominant allele to half their offspring of both sexes, while affected males (X^A Y) pass the dominant allele to all daughters but no sons.
  11. 11. a) The figure showing the ruptured mature (Graafian) follicle illustrates ovulation; it represents release of a secondary oocyte arrested in metaphase II. b) Ovarian hormone: estrogen (produced by the mature follicle); Pituitary hormone: LH (luteinizing hormone surge). c) Uterine changes: endometrium moves from proliferative to secretory phase under progesterone (after corpus luteum forms): becomes thicker, more glandular and vascularized; glands secrete nutrient-rich fluid preparing for implantation. d) Difference between C and H (assumed C = corpus luteum; H = corpus albicans): corpus luteum is yellow, functional, secretes progesterone and some estrogen; corpus albicans is a pale fibrous scar (degenerate corpus luteum), non-functional and hormone-inactive.
  12. 12. Syngamy refers to the fusion of two gametes to form a zygote, and different types of syngamy are classified based on the morphology and motility of the fusing gametes. Isogamy is the fusion of two morphologically similar and equally motile gametes, as seen in many algae and fungi where both gametes appear identical. Anisogamy involves the fusion of two gametes that differ in size and morphology, where one gamete is larger and less motile than the other, observed in certain algae and protozoans. Oogamy is the fusion of a large, non-motile female gamete (ovum) with a small, motile male gamete (sperm), which is the most common type of syngamy in higher animals and plants. These different types of syngamy reflect variations in sexual reproduction strategies across different organisms.
  13. 13. b) Echinodermata Explanation: Echinoderm adults (e.g., sea stars, sea urchins) display radial (usually pentaradial) symmetry, whereas their larvae (for example, bipinnaria or pluteus larvae) are bilaterally symmetrical. This change reflects their planktonic larval stage and sedentary/adult body plan.
  14. 14. RNA is considered the first genetic material because it can both store information and act as a catalyst (ribozyme), can self-replicate under plausible prebiotic conditions, and modern evidence (ribozymes, central role of RNA in translation) supports an RNA world preceding DNA/protein biology.
  15. 15. A is true, R is false
  16. 16. The phenomenon where the female gamete directly develops into a new organism without fertilization is called parthenogenesis. An avian example is the domestic turkey (Meleagris gallopavo), where unfertilized eggs can develop into offspring. In this process, the haploid egg undergoes mitotic divisions to produce a diploid organism, bypassing the need for male gamete fusion. This form of asexual reproduction is particularly common in certain bird species and some other animals.
  17. 17. Criss-cross inheritance is the pattern of inheritance of X-linked genes where the trait appears to skip generations or pass from one sex to the other in an alternating pattern. In this inheritance pattern, a gene is transmitted from an affected male parent to his carrier daughter (who is phenotypically normal if the allele is recessive) and then to an affected grandson through the daughter. Alternatively, a carrier female can pass the recessive allele to her son who expresses the trait, and then the trait can reappear in the granddaughter if she inherits the allele from her affected father. The characteristic criss-cross pattern occurs because males have only one X chromosome, so they express X-linked recessive traits, while heterozygous females typically do not express recessive traits but can transmit them to their offspring. Classic examples of criss-cross inheritance include X-linked traits such as colour blindness and haemophilia, where affected males have unaffected carrier daughters whose sons may be affected.
  18. 18. Eurytherms are organisms that can tolerate a wide range of temperatures and thrive across different thermal environments, maintaining normal metabolic and physiological functions over a broad temperature spectrum. Examples include many mammals, birds, insects, and plants found in diverse climates. Stenotherms, in contrast, can tolerate only a narrow temperature range and are restricted to specific thermal habitats; they have limited ability to adjust their physiology to temperature changes. Examples include many tropical fish, reptiles, and organisms adapted to stable thermal environments like deep ocean waters or polar regions. This difference reflects their evolutionary adaptation to different environmental conditions and their physiological flexibility or specialization.
  19. 19. a) ZIFT stands for Zygote Intrafallopian Transfer, a technique in which a fertilized ovum or zygote is collected and transferred into the fallopian tube to allow natural development and implantation. b) ICSI stands for Intracytoplasmic Sperm Injection, a specialized micromanipulation technique used in assisted reproduction in which a single sperm is injected directly into the cytoplasm of a mature oocyte to achieve fertilization, particularly useful in cases of severe male factor infertility.
  20. 20. The mRNA sequence transcribed from the given DNA coding sequence is synthesized in the 5'→3' direction, with uracil replacing thymine. Since the DNA coding sequence is 5' TGCATGCATGCATGCATGCATGCATGC 3', the corresponding mRNA sequence (5'→3') is 5' UGCAUGCAUGCAUGCAUGCAUGCAUGC 3', where each thymine (T) in the DNA is replaced by uracil (U) in the RNA, and all other bases remain the same.
  21. 21. A and R are true, R is the correct explanation of A
  22. 22. Amoeba is an organism where cell division itself serves as a mode of reproduction. In amoeba, the unicellular body undergoes binary fission, a form of asexual reproduction where the parent cell divides into two identical daughter cells. This process involves mitotic division of the nucleus followed by division of the cytoplasm, resulting in two genetically identical offspring. Binary fission is a simple and rapid method of reproduction that allows amoeba to increase its population quickly under favorable conditions.
  23. 23. Major gases of primitive Earth: methane (CH4), ammonia (NH3), hydrogen (H2), water vapour (H2O), nitrogen (N2) and carbon dioxide (CO2).
  24. 24. Down's syndrome, also called trisomy 21, is a chromosomal disorder caused by the presence of three copies of chromosome 21 instead of the normal two copies. The characteristic symptoms include severe mental retardation or intellectual disability of varying degrees. Affected individuals show defective development of the central nervous system, resulting in developmental delays and learning difficulties. Distinctive facial features include increased separation between the eyes (hypertelorism), a flattened nose with a low nasal bridge, and malformed ears that may be small or positioned lower than normal. The mouth is characteristically held open and the tongue protrudes, a condition called macroglossia. Additional features often include short stature, poor muscle tone (hypotonia), congenital heart defects, and increased susceptibility to infections. Individuals with Down's syndrome may also have hearing and vision problems. Despite these challenges, many individuals with Down's syndrome can learn to perform daily activities and some can be employed with appropriate support and education.
  25. 25. The diagnosis is malaria, an infectious disease caused by Plasmodium species parasites. The presence of merozoites in the blood is a characteristic finding that confirms malaria infection. Merozoites are the asexual stage of the Plasmodium parasite that are released from infected red blood cells and invade new erythrocytes, causing their rupture and the characteristic fever and chills associated with malaria. The fever and chills pattern corresponds to the synchronized rupture of infected red blood cells at regular intervals, typically every 48 or 72 hours depending on the Plasmodium species involved. Microscopic examination of blood smears showing merozoites, along with clinical symptoms of fever and chills, is a standard diagnostic method for malaria confirmation.
  26. 26. Sex determination in humans follows an XY chromosomal system where males are heterogametic and females are homogametic. Females have two X chromosomes (XX) and produce eggs that all contain a single X chromosome. Males have one X chromosome and one Y chromosome (XY) and produce two types of sperm, approximately half carrying an X chromosome and half carrying a Y chromosome. During fertilization, if an X-bearing sperm fertilizes an egg, the resulting zygote has an XX chromosome combination and develops as a female. If a Y-bearing sperm fertilizes an egg, the resulting zygote has an XY chromosome combination and develops as a male. Therefore, the sex of the offspring is determined by the male parent, as the sperm contributes either an X or Y chromosome. The Y chromosome carries the sex-determining region (SRY gene) which triggers the development of male characteristics. In the absence of the Y chromosome and SRY gene, the default developmental pathway results in female characteristics. This chromosomal mechanism of sex determination is consistent and reliable, producing approximately equal numbers of male and female offspring in populations.
  27. 27. Soil permeability is the ability of soil to allow water and gases to pass through its pore spaces, which is essential for water drainage, aeration, and nutrient availability to plant roots. Permeability depends on several factors including soil texture (the proportion of sand, silt, and clay particles), soil structure (the arrangement and aggregation of particles), and pore connectivity (the degree to which pores are interconnected). Sandy soils generally have high permeability due to larger pore spaces, while clay soils have low permeability because fine particles create smaller, less connected pores. Soil structure, influenced by organic matter content and biological activity, can significantly modify permeability. Proper soil permeability is critical for plant growth, as it affects water availability, oxygen diffusion, and the leaching of nutrients and contaminants.
  28. 28. The offspring formed by asexual reproduction are referred to as clones because they are genetically identical to the parent organism and to each other. Asexual reproduction occurs through mitosis, which produces daughter cells with the exact same genetic information as the parent cell. Since no genetic recombination or variation occurs during mitotic division, all offspring are genetically uniform copies of the parent. A clone is defined as a group of genetically identical individuals derived from a single parent through asexual reproduction, making this term particularly appropriate for describing the products of asexual reproduction.
  29. 29. The cloning of Dolly the sheep in 1996 was a major scientific breakthrough because it definitively demonstrated that a fully differentiated adult somatic cell nucleus retains all the genetic information necessary to direct the development of an entire organism. Prior to Dolly's creation, the prevailing scientific view was that differentiation was largely irreversible and that adult somatic cell nuclei had lost the ability to support full development. Dolly was produced through somatic cell nuclear transfer (SCNT), in which the nucleus from an adult mammary gland cell of a donor sheep was transferred into an enucleated egg cell from another sheep, and the reconstructed embryo was then implanted into a surrogate mother. The successful birth of Dolly proved that the genetic material in the adult somatic cell nucleus could be reprogrammed by the cytoplasm of the egg cell to a totipotent state, capable of directing the development of all cell types and tissues in the body. This demonstrated the principle of genomic equivalence, which states that all cells in an organism contain the same genetic information despite their different phenotypes and functions. The reprogramming of the differentiated nucleus to totipotency by the egg cytoplasm revealed that differentiation involves reversible changes in gene expression rather than permanent loss of genetic material. Dolly's creation opened new frontiers in reproductive biology, regenerative medicine, and biotechnology, enabling the possibility of producing cloned animals for research, agriculture, and potentially therapeutic purposes. The breakthrough also raised important questions about the nature of development, cellular differentiation, and the ethical implications of cloning technology.
  30. 30. Prevention of sexually transmitted diseases requires a comprehensive and multi-faceted approach. Consistent and correct use of condoms during all sexual encounters provides a significant barrier against most STDs. Practicing mutual monogamy with an uninfected partner or maintaining abstinence eliminates sexual transmission risk. Vaccination against certain STDs such as hepatitis B virus (HBV) and human papillomavirus (HPV) provides immunological protection. Routine screening and early diagnosis followed by prompt treatment of infected persons prevents progression and transmission to partners. Ensuring safe blood transfusions through proper screening of donors and use of sterile needles in medical settings prevents blood-borne transmission. Comprehensive sex education and counselling programs increase awareness about risks and preventive measures. Partner notification and treatment ensures that sexual contacts of infected individuals are identified and treated, breaking the transmission chain. Safe childbirth practices including cesarean delivery when necessary and avoiding breastfeeding by infected mothers prevent vertical transmission to newborns. These measures collectively form an integrated strategy for STD prevention and control.
  31. 31. Gametogenesis is the biological process by which haploid gametes, namely spermatozoa in males and ova in females, are produced from diploid germ cells located in the gonads. The process involves three main components: mitosis, which increases the number of germ cells; meiosis, which reduces the chromosome number from diploid to haploid; and differentiation, which transforms the products of meiosis into functional, specialized gametes. In males, spermatogenesis occurs continuously in the seminiferous tubules of the testes from puberty throughout adult life, producing millions of motile sperm daily. In females, oogenesis begins during fetal development, arrests in prophase I of meiosis I, and resumes cyclically during the menstrual cycle from menarche to menopause, typically producing one mature ovum per cycle. Both processes are regulated by gonadotropic hormones, follicle-stimulating hormone (FSH) and luteinizing hormone (LH), which are secreted by the anterior pituitary gland. Gametogenesis is essential for sexual reproduction, as it generates the genetic diversity necessary for offspring and ensures the transmission of genetic material from parents to the next generation.
  32. 32. Adaptive traits found in organisms can be classified into several categories based on their nature and function. Morphological or structural adaptations involve changes in body shape, size, color, or anatomical features that enhance survival and reproduction, such as the streamlined body of fish for aquatic movement, the long neck of giraffes for reaching high vegetation, or the camouflage coloration of insects. Physiological adaptations are internal functional adjustments that improve survival, including thermoregulation, osmoregulation, enzyme modifications, and metabolic adjustments to environmental conditions. Behavioral adaptations involve changes in actions and responses, such as migration patterns, feeding strategies, mating displays, parental care, and predator avoidance behaviors. Reproductive and developmental adaptations relate to breeding strategies, timing of reproduction, number of offspring, and developmental patterns that maximize reproductive success in specific environments. Biochemical adaptations involve molecular and chemical modifications such as the production of antifreeze proteins in polar fish, toxins in plants for defense, or specialized pigments for light absorption. These categories often overlap, and organisms typically possess multiple types of adaptations that work together to increase fitness in their particular ecological niche.
  33. 33. Divergent evolution and convergent evolution represent two contrasting patterns of evolutionary change. Divergent evolution occurs when related species that share a common ancestor evolve different traits and adaptations as they become isolated and experience different environmental pressures, resulting in the development of homologous structures that are similar in basic structure and embryological origin but different in form and function. A classic example is the forelimbs of vertebrates, where the human arm, bat wing, whale flipper, and horse leg all share the same basic bone structure (humerus, radius, ulna, carpals, metacarpals, and phalanges) inherited from a common mammalian ancestor, but have been modified for different functions such as grasping, flying, swimming, and running respectively. Convergent evolution, by contrast, occurs when unrelated or distantly related species independently evolve similar traits and structures in response to similar environmental pressures or ecological niches, resulting in the development of analogous structures that are similar in function but different in structure and evolutionary origin. A classic example is the wings of birds (which are modified forelimbs of vertebrates with feathers) and the wings of butterflies or insects (which are extensions of the body wall with a different internal structure), both of which function for flight but evolved independently from different ancestral structures in different lineages.
  34. 34. Autoimmunity represents a fundamental failure of immune tolerance, wherein the immune system misdirects its protective mechanisms against the body's own tissues and cells. Normally, self-tolerance is maintained through central tolerance in the thymus and bone marrow, where self-reactive lymphocytes are eliminated, and peripheral tolerance, where regulatory T cells and other mechanisms suppress autoreactive cells. When self-tolerance fails, autoreactive B cells produce autoantibodies against self-antigens, and autoreactive T cells directly attack self-tissues, causing chronic inflammation and tissue damage. This misdirected response occurs due to genetic predisposition, environmental triggers, infections, or breakdown of regulatory mechanisms. Rheumatoid arthritis exemplifies autoimmunity where antibodies attack joint tissues causing inflammation and destruction. Type 1 diabetes results from T cell destruction of insulin-producing pancreatic beta cells. Systemic lupus erythematosus involves widespread autoantibodies against nuclear antigens affecting multiple organs. Other examples include multiple sclerosis, where immune cells attack myelin in the nervous system, and Graves' disease, where antibodies stimulate thyroid hormone production. The chronic nature of autoimmune diseases reflects the persistent failure of immune regulation, making them difficult to cure and requiring long-term immunosuppressive management.
  35. 35. Antibiotic resistance develops when bacteria are exposed to antibiotics and naturally occurring or mutated resistant variants survive and proliferate because susceptible bacteria are eliminated. The primary cause is overuse and misuse of antibiotics, including incomplete antibiotic courses where patients discontinue medication prematurely, unnecessary prescriptions for viral infections where antibiotics are ineffective, and indiscriminate use in agriculture and animal husbandry. This creates strong selection pressure favoring the survival and multiplication of resistant mutants that possess genes conferring resistance. Horizontal gene transfer mechanisms, including transfer of plasmids and transposons carrying resistance genes between bacterial cells, accelerate the spread of resistance traits across different bacterial species and populations. Poor infection control practices in healthcare settings allow resistant bacteria to spread more readily among patients. The widespread use of antibiotics in agriculture for growth promotion and disease prevention in livestock further accelerates the development and dissemination of antibiotic-resistant bacteria. Once resistance develops, resistant bacteria can persist in the environment and human population, making previously effective antibiotics ineffective for treatment, posing a serious threat to public health.
  36. 36. Habitat loss is the primary driver of biodiversity decline, and multiple human activities contribute to this loss. Deforestation is a major driver, occurring through agricultural expansion to create croplands and pastures, commercial logging for timber and paper products, and clearing for infrastructure development. Urbanization and the expansion of human settlements destroy natural habitats, fragmenting landscapes and isolating wildlife populations. Mining operations remove vegetation and soil, creating barren landscapes and contaminating water sources. Pollution from industrial discharge, agricultural runoff, and plastic waste degrades habitats and makes them unsuitable for many species. Dam construction floods valleys and alters river ecosystems, disrupting fish migration and aquatic habitats. Invasive species introduced by human activity outcompete native species and alter ecosystem structure and function. Overgrazing by livestock degrades grasslands and reduces vegetation cover. Climate change alters temperature and precipitation patterns, shifting suitable habitats for species and causing mismatches between species and their food sources. Coastal development and fishing practices damage marine habitats such as coral reefs and mangroves. Agricultural intensification through monoculture farming and pesticide use reduces habitat complexity and eliminates food sources for wildlife. These drivers often act synergistically, with multiple stressors affecting habitats simultaneously, making recovery difficult. Addressing habitat loss requires reducing deforestation, protecting remaining natural areas, restoring degraded habitats, controlling invasive species, reducing pollution, and mitigating climate change through sustainable practices and policy changes.
  37. 37. The Red Data Book, officially known as the IUCN Red List of Threatened Species, is a comprehensive catalogue of taxa (species, subspecies, varieties) that have been assessed for their risk of extinction. It is maintained by the International Union for Conservation of Nature (IUCN) and provides detailed information on the conservation status of species worldwide. The purposes of the Red Data Book are multifaceted. First, it documents and categorizes species' conservation status using standardized criteria, assigning them to categories such as Extinct, Extinct in the Wild, Critically Endangered, Endangered, Vulnerable, Near Threatened, Least Concern, and Data Deficient. Second, it raises global awareness about biodiversity loss and the threats facing species, informing the public and policymakers about conservation needs. Third, it guides conservation priorities by identifying which species require urgent intervention and resources. Fourth, it informs policy and legislation at national and international levels, helping governments establish protected areas and implement species recovery programs. Finally, it provides a scientific basis for management and recovery actions, enabling conservationists and wildlife managers to develop evidence-based strategies for protecting endangered species and preventing extinctions.
  38. 38. Common wastes generated at home include organic wastes such as kitchen scraps, food leftovers, and yard waste; paper products including newspapers, cardboard, and office paper; plastic items such as bags, bottles, containers, and packaging materials; glass bottles and jars; metal cans and containers; electronic waste including batteries, chargers, mobile phones, and computer components; sanitary waste such as diapers and menstrual products; textiles including worn clothing and fabric scraps; and hazardous household chemicals including cleaning products, pesticides, and paint. At school, wastes include paper from notebooks and printouts, plastic from food packaging and water bottles, food waste from cafeterias, and e-waste from computers and electronic devices. During trips, wastes include single-use plastic bottles, food packaging, plastic bags, and other disposable items. Many of these wastes can be easily reduced through conscious effort. Single-use plastics can be eliminated by carrying reusable bags, bottles, and containers. Paper waste can be significantly reduced by using digital alternatives for notes and documents, printing double-sided, and reusing paper. Food waste can be minimized through meal planning, proper storage, and composting of unavoidable organic waste. Packaging waste can be reduced by purchasing products with minimal packaging and carrying reusable containers when shopping. However, some wastes are difficult or nearly impossible to reduce with current infrastructure and technology. Certain electronic wastes are unavoidable due to the necessity of using electronic devices, though their lifespan can be extended through proper maintenance. Medical and sanitary wastes are difficult to reduce as they are essential for health and hygiene. Some packaged goods remain necessary due to current manufacturing and distribution systems that prioritize shelf-life and food safety. Hazardous waste reduction requires alternative products that may not be readily available or affordable. Reducing these difficult wastes requires systemic changes in manufacturing practices, development of alternative materials, and improved waste management infrastructure rather than individual action alone.

📄 Official Tamil Nadu Question Papers

Want the real previous-year & sample papers? Download them free from the official board sites:

Practise more — your way

⚙️ Generate unlimited custom papers🎯 Practise MCQs & earn XP

Every paper above is generated from the same 23,000+ verified Brain Grain question bank.