Brain Grain · braingrain.in
Zoology — Practice Paper · Set 1
Class: 12Samacheer KalviMax Marks: 92
Name: ____________________Reg No: ____________
Part I — Multiple Choice Questions 14 × 1 = 14
Choose the correct answer. (Answer all questions.)
1.Explain the different kinds of syngamy in living organisms.[1]
2.Explain the inheritance of sex linked characters in human being.[1]
3.In which of the following phyla, the adult shows radial symmetry but the larva shows bilateral symmetry? a. Mollusca b. Echinodermata c. Arthropoda d. Annelida[1]
4.Why do you think it is not possible to produce vaccine against 'common cold'?[1]
5.Open Book Assessment: 'Healthy reproduction, legally checked birth control measures and proper family planning programmes are essential for the survival of mankind.' Justify.[1]
6.What are the effects of noise pollution?[1]
7.The following is the illustration of the sequence of ovarian events (a-i) in a human female. a) Identify the figure that illustrates ovulation and mention the stage of oogenesis it represents. b) Name the ovarian hormone and the pituitary hormone that have caused the above-mentioned events. c) Explain the changes that occurs in the uterus simultaneously in anticipation. d) Write the difference between C and H.[1]
8.Differentiate between the following: (a) External and Internal fertilization (b) Regeneration in lizard and Planaria[1]
9.What is bioremediation?[1]
10.It is established that RNA is the first genetic material. Justify giving reasons.[1]
11.How does Neanderthal man differ from the modern man in appearance?[1]
12.Tabulate and analysis of two species population interaction.[1]
13.Explain how recombinant insulin can be produced.[1]
14.Write a note on (i) Protected areas and (ii) Wildlife Sanctuaries.[1]
Part II — Short Answer Questions 14 × 2 = 28
Answer briefly. (Answer all questions.)
15.A - Ovulation is the release of ovum from the Graafian follicle. R - It occurs during the follicular phase of the menstrual cycle. Choose correct relation.[2]
16.List out the major gases seems to be found in the primitive earth.[2]
17.If the coding sequence in a transcription unit is written as follows: 5' TGCATGCATGCATGCATGCATGCATGC 3' Write down the sequence of mRNA.[2]
18.A patient was hospitalized with fever and chills. Merozoites were observed in her blood. What is your diagnosis?[2]
19.What is criss-cross inheritance?[2]
20.Differentiate between Eurytherms and Stenotherms.[2]
21.What is Acclimatisation?[2]
22.Name the active chemical found in the medicinal plant Rauwolfia vomitoria. What type of diversity it belongs to?[2]
23.Brief about female heterogamety.[2]
24.What is male heterogamety?[2]
25.How is sex determined in human beings?[2]
26.How many hotspots are there in India? Name them.[2]
27.Mention the symptoms of Down's syndrome.[2]
28.Why is the offspring formed by asexual reproduction referred as a clone?[2]
Part III — Long Answer Questions 10 × 5 = 50
Answer in detail. (Answer all questions.)
29.How is polyspermy avoided in humans?[5]
30.Name the parts marked 'A' and 'B' in the given transcription unit: 5' 3' A 3' 5' B[5]
31.What are some solutions to toxic dumping in our oceans?[5]
32.Why tRNA is called an adapter molecule?[5]
33.How can we contribute to promote biodiversity conservation?[5]
34.Explain the formation of a nucleosome.[5]
35.Describe Growth Models/Curves.[5]
36.Explain the genetic basis of ABO blood grouping in man.[5]
37.Placenta is an endocrine tissue. Justify.[5]
38.Differentiate J and S shaped curve.[5]
🔑 Show Answer Key — Set 1
- 1. Syngamy refers to the fusion of two gametes to form a zygote, and different types of syngamy are classified based on the morphology and motility of the fusing gametes. Isogamy is the fusion of two morphologically similar and equally motile gametes, as seen in many algae and fungi where both gametes appear identical. Anisogamy involves the fusion of two gametes that differ in size and morphology, where one gamete is larger and less motile than the other, observed in certain algae and protozoans. Oogamy is the fusion of a large, non-motile female gamete (ovum) with a small, motile male gamete (sperm), which is the most common type of syngamy in higher animals and plants. These different typ…
- 2. Sex-linked characters in humans are traits controlled by genes located on the sex chromosomes, primarily the X chromosome. Since males have only one X chromosome (XY), they express both dominant and recessive alleles on the X chromosome, making them hemizygous. Females have two X chromosomes (XX), so they can be homozygous or heterozygous for X-linked traits. For X-linked recessive traits like color blindness and hemophilia, affected males have the genotype X^a Y where X^a represents the recessive allele. Carrier females have the genotype X^A X^a (one normal and one mutant allele) and typically show the dominant phenotype but can pass the recessive allele to offspring. When a carrier fema…
- 3. b) Echinodermata Explanation: Echinoderm adults (e.g., sea stars, sea urchins) display radial (usually pentaradial) symmetry, whereas their larvae (for example, bipinnaria or pluteus larvae) are bilaterally symmetrical. This change reflects their planktonic larval stage and sedentary/adult body plan.
- 4. It is not possible to produce an effective vaccine against the common cold due to several interconnected factors related to viral diversity and immune response characteristics. The common cold is caused by more than 100 different virus serotypes, primarily rhinoviruses, but also including coronaviruses, adenoviruses, enteroviruses, and parainfluenza viruses. This extreme antigenic diversity means that immunity to one serotype does not provide protection against others, making a single vaccine impractical. Additionally, these viruses undergo frequent antigenic variation and mutation, allowing them to evade previously acquired immunity. The common cold viruses primarily infect the upper res…
- 5. Healthy reproduction, legally regulated birth control measures, and proper family planning programmes are essential for mankind's survival for several interconnected reasons. Healthy reproduction ensures that children are born with minimal genetic and developmental abnormalities, reducing infant and child mortality and promoting the birth of healthy individuals who can contribute productively to society. Legally checked birth control measures prevent unsafe and unregulated practices that endanger women's health and lives. Proper family planning programmes enable couples to space pregnancies appropriately, reducing maternal and child health risks associated with frequent pregnancies and al…
- 6. Noise pollution produces a wide range of harmful effects on both human health and wildlife. Auditory effects include hearing loss, which can result from prolonged exposure to loud sounds, and tinnitus, a persistent ringing in the ears that can significantly impact quality of life. Physiological stress responses occur when organisms are exposed to excessive noise, leading to elevated blood pressure, increased heart rate, and elevated levels of stress hormones such as cortisol. These physiological changes can contribute to cardiovascular disease and other stress-related health conditions. Sleep disturbance is a major consequence of noise pollution, as continuous or intermittent loud sounds…
- 7. a) The figure showing the ruptured mature (Graafian) follicle illustrates ovulation; it represents release of a secondary oocyte arrested in metaphase II. b) Ovarian hormone: estrogen (produced by the mature follicle); Pituitary hormone: LH (luteinizing hormone surge). c) Uterine changes: endometrium moves from proliferative to secretory phase under progesterone (after corpus luteum forms): becomes thicker, more glandular and vascularized; glands secrete nutrient-rich fluid preparing for implantation. d) Difference between C and H (assumed C = corpus luteum; H = corpus albicans): corpus luteum is yellow, functional, secretes progesterone and some estrogen; corpus albicans is a pale fibrou…
- 8. (a) External fertilization: gametes fuse outside body (aquatic animals, many fishes/amphibians), many small gametes, often large number of offspring and less parental care. Internal fertilization: gametes fuse inside body (terrestrial animals, mammals, birds), fewer gametes, greater parental care. (b) Regeneration: Lizard — limited regeneration (mainly tail) via blastema; replacement is partial and tissue types more restricted. Planaria — extensive regeneration: any small fragment can regenerate whole organism due to abundant pluripotent neoblasts.
- 9. Bioremediation is an environmental biotechnology approach that uses living organisms, primarily microorganisms such as bacteria and fungi, and plants to degrade, detoxify, or remove pollutants and contaminants from contaminated environments. The process can be implemented through two main strategies: in situ bioremediation, where contamination is treated at the site of pollution without removing the contaminated material, and ex situ bioremediation, where contaminated soil or water is excavated or extracted and treated in a controlled facility away from the original site. Microorganisms employed in bioremediation possess enzymatic capabilities to break down various pollutants including pe…
- 10. RNA is considered the first genetic material because it can both store information and act as a catalyst (ribozyme), can self-replicate under plausible prebiotic conditions, and modern evidence (ribozymes, central role of RNA in translation) supports an RNA world preceding DNA/protein biology.
- 11. Neanderthal man (Homo neanderthalensis) differed from modern humans (Homo sapiens) in several significant anatomical features. Neanderthals were more robust and heavily built with a stockier body structure adapted to cold climates, whereas modern humans are more gracile and lightly built. Neanderthals possessed heavy, prominent brow ridges above their eyes, while modern humans have smooth foreheads. The forehead of Neanderthals was low and receding, sloping backward, whereas modern humans have a vertical, prominent forehead. Neanderthals had a large nose, which may have been an adaptation for warming cold air before it entered the lungs, while modern humans have a smaller, more prominent…
- 12. Two-species population interactions can be analyzed and tabulated based on the effects on each species, represented by + (positive effect), − (negative effect), or 0 (no effect). Competition (−/−) occurs when both species are negatively affected as they utilize the same limited resources, reducing fitness and survival of both. Predation and parasitism (+/−) involve one species (predator or parasite) benefiting while the other (prey or host) is harmed; the predator gains nutrition while the prey population decreases. Mutualism (+/+) is a mutually beneficial interaction where both species gain advantages, such as flowering plants and their pollinators or nitrogen-fixing bacteria and legumes…
- 13. Recombinant insulin is produced through a multi-step biotechnological process that involves genetic engineering and protein expression in microbial hosts. The first step is to identify and isolate the human insulin gene or the genes encoding the individual insulin A and B chains, or alternatively, the proinsulin gene, which encodes a single-chain precursor that is later processed into mature insulin. The isolated insulin gene or cDNA is then inserted into an expression vector, which is a plasmid or viral DNA construct containing regulatory sequences such as promoters and terminators that control gene expression. The recombinant expression vector is introduced into a suitable microbial hos…
- 14. Protected areas are designated regions of land or water specifically managed for the conservation of biodiversity, ecosystem services, and genetic resources. They include national parks, wildlife sanctuaries, biosphere reserves, and other conservation designations. Protected areas function as in situ conservation sites where species are protected within their natural habitats and ecological communities are maintained. They serve multiple purposes including preserving representative ecosystems, protecting endangered species, maintaining ecosystem services such as water purification and carbon sequestration, supporting scientific research, and providing educational opportunities. Protected…
- 15. A is true, R is false
- 16. Major gases of primitive Earth: methane (CH4), ammonia (NH3), hydrogen (H2), water vapour (H2O), nitrogen (N2) and carbon dioxide (CO2).
- 17. The mRNA sequence transcribed from the given DNA coding sequence is synthesized in the 5'→3' direction, with uracil replacing thymine. Since the DNA coding sequence is 5' TGCATGCATGCATGCATGCATGCATGC 3', the corresponding mRNA sequence (5'→3') is 5' UGCAUGCAUGCAUGCAUGCAUGCAUGC 3', where each thymine (T) in the DNA is replaced by uracil (U) in the RNA, and all other bases remain the same.
- 18. The diagnosis is malaria, an infectious disease caused by Plasmodium species parasites. The presence of merozoites in the blood is a characteristic finding that confirms malaria infection. Merozoites are the asexual stage of the Plasmodium parasite that are released from infected red blood cells and invade new erythrocytes, causing their rupture and the characteristic fever and chills associated with malaria. The fever and chills pattern corresponds to the synchronized rupture of infected red blood cells at regular intervals, typically every 48 or 72 hours depending on the Plasmodium species involved. Microscopic examination of blood smears showing merozoites, along with clinical symptoms…
- 19. Criss-cross inheritance is the pattern of inheritance of X-linked genes where the trait appears to skip generations or pass from one sex to the other in an alternating pattern. In this inheritance pattern, a gene is transmitted from an affected male parent to his carrier daughter (who is phenotypically normal if the allele is recessive) and then to an affected grandson through the daughter. Alternatively, a carrier female can pass the recessive allele to her son who expresses the trait, and then the trait can reappear in the granddaughter if she inherits the allele from her affected father. The characteristic criss-cross pattern occurs because males have only one X chromosome, so they exp…
- 20. Eurytherms are organisms that can tolerate a wide range of temperatures and thrive across different thermal environments, maintaining normal metabolic and physiological functions over a broad temperature spectrum. Examples include many mammals, birds, insects, and plants found in diverse climates. Stenotherms, in contrast, can tolerate only a narrow temperature range and are restricted to specific thermal habitats; they have limited ability to adjust their physiology to temperature changes. Examples include many tropical fish, reptiles, and organisms adapted to stable thermal environments like deep ocean waters or polar regions. This difference reflects their evolutionary adaptation to di…
- 21. Acclimatisation is the reversible physiological, morphological or behavioural adjustment of an individual organism to changes in its environment. These adjustments occur within the lifetime of an organism and allow it to cope with environmental stress or variation. A classic example is the increase in red blood cell production in humans at high altitude, which enhances oxygen-carrying capacity in response to lower atmospheric oxygen. Other examples include thickening of skin in response to cold, changes in enzyme activity to match temperature fluctuations, and behavioral modifications such as altered feeding patterns or activity timing. Unlike adaptation, which is a genetic change occurri…
- 22. The active chemical found in the medicinal plant Rauwolfia vomitoria is reserpine, an alkaloid used in treating hypertension and psychiatric disorders. Reserpine exemplifies biochemical diversity, which is a facet of genetic diversity. Biochemical diversity refers to the variety of chemical compounds and metabolites produced by different organisms, reflecting the genetic differences that encode the enzymes and pathways for synthesizing these compounds. This diversity has immense value for medicine, agriculture, and industry.
- 23. Female heterogamety (ZO females) refers to the condition where female produces two types of egg cells. Some with Z chromosome and some without Z chromosome. This pattern occurs in birds, butterflies, and some other organisms where females have ZO sex chromosomes (one Z and no second sex chromosome) while males have ZZ chromosomes. During meiosis in females, the Z chromosome segregates into some eggs while other eggs receive no sex chromosome (O). When a Z-bearing egg is fertilized by a Z-bearing sperm from the male, the offspring is female (ZO). When an O-bearing egg is fertilized by a Z-bearing sperm, the offspring is male (ZZ). Thus, in this system, females are heterogametic and determi…
- 24. Male heterogamety refers to the condition where males produce two different types of gametes (sperm cells) during meiosis. In mammals including humans, males have XY sex chromosomes, so they produce two types of sperm: some carrying the X chromosome and some carrying the Y chromosome. When a sperm carrying the X chromosome fertilizes an egg (which always carries an X chromosome), the resulting offspring is female (XX). When a sperm carrying the Y chromosome fertilizes an egg, the resulting offspring is male (XY). Thus, males are the heterogametic sex because they determine the sex of the offspring through their gamete contribution.
- 25. Sex determination in humans follows an XY chromosomal system where males are heterogametic and females are homogametic. Females have two X chromosomes (XX) and produce eggs that all contain a single X chromosome. Males have one X chromosome and one Y chromosome (XY) and produce two types of sperm, approximately half carrying an X chromosome and half carrying a Y chromosome. During fertilization, if an X-bearing sperm fertilizes an egg, the resulting zygote has an XX chromosome combination and develops as a female. If a Y-bearing sperm fertilizes an egg, the resulting zygote has an XY chromosome combination and develops as a male. Therefore, the sex of the offspring is determined by the ma…
- 26. Two hotspots: Western Ghats and Eastern Himalayas.
- 27. Down's syndrome, also called trisomy 21, is a chromosomal disorder caused by the presence of three copies of chromosome 21 instead of the normal two copies. The characteristic symptoms include severe mental retardation or intellectual disability of varying degrees. Affected individuals show defective development of the central nervous system, resulting in developmental delays and learning difficulties. Distinctive facial features include increased separation between the eyes (hypertelorism), a flattened nose with a low nasal bridge, and malformed ears that may be small or positioned lower than normal. The mouth is characteristically held open and the tongue protrudes, a condition called m…
- 28. The offspring formed by asexual reproduction are referred to as clones because they are genetically identical to the parent organism and to each other. Asexual reproduction occurs through mitosis, which produces daughter cells with the exact same genetic information as the parent cell. Since no genetic recombination or variation occurs during mitotic division, all offspring are genetically uniform copies of the parent. A clone is defined as a group of genetically identical individuals derived from a single parent through asexual reproduction, making this term particularly appropriate for describing the products of asexual reproduction.
- 29. Polyspermy, the entry of multiple sperm into an ovum, is prevented in humans primarily through the cortical reaction. When the first sperm fuses with the oocyte membrane, this triggers the cortical reaction, a process in which cortical granules present in the cytoplasm of the oocyte release their contents into the perivitelline space. These granules contain enzymes and other substances that modify the zona pellucida, the glycoprotein layer surrounding the oocyte. Specifically, the enzymes alter the zona pellucida glycoproteins, particularly ZP3 receptors which are responsible for sperm binding, making them unable to bind additional sperm. The zona pellucida also hardens and thickens follo…
- 30. In the given transcription unit, A represents the coding strand (also called the sense or non-template strand) with polarity 5' → 3', and B represents the template strand (also called the antisense strand) with polarity 3' → 5'. The template strand (B) is the strand that serves as the template for RNA synthesis by RNA polymerase. RNA polymerase reads the template strand in the 3' to 5' direction and synthesizes mRNA in the 5' to 3' direction, with the mRNA sequence being complementary and antiparallel to the template strand. The coding strand (A) has the same sequence as the mRNA (except thymine instead of uracil) and runs in the 5' to 3' direction, which is why it is called the sense str…
- 31. Solutions to toxic dumping in our oceans involve a multi-faceted approach combining legal, technological, and regulatory measures. International conventions such as MARPOL (International Convention for the Prevention of Pollution from Ships) and the London Convention establish frameworks to regulate and prevent ocean dumping of hazardous materials. Strengthening monitoring systems and imposing stricter penalties on violators acts as a deterrent to illegal dumping activities. Improving industrial waste treatment processes ensures that waste is properly processed before disposal, reducing the amount of toxic material entering marine ecosystems. Promoting safe disposal methods and land-based…
- 32. tRNA is called an adapter molecule because it performs the critical function of linking the language of nucleic acids to the language of proteins during translation. At its 3' CCA end, tRNA carries a specific amino acid that is attached by aminoacyl-tRNA synthetase enzymes. At its other end, tRNA possesses an anticodon loop containing a three-nucleotide anticodon sequence that is complementary to and recognizes the corresponding mRNA codon on the ribosome. This dual recognition capability allows tRNA to bridge the gap between the genetic code written in mRNA codons and the amino acid sequence of the protein being synthesized, thus acting as an essential adapter that translates the nucleot…
- 33. Individuals can significantly contribute to biodiversity conservation through multiple practical actions. Practicing sustainable living by reducing consumption, reusing materials, and recycling waste minimizes resource extraction and pollution that threaten ecosystems. Supporting protected areas through donations, volunteering, and advocacy helps ensure their effective management and expansion. Using native plants in gardens and landscaping provides food and habitat for local wildlife while reducing water and pesticide requirements. Avoiding purchase and use of wildlife products derived from endangered species, such as ivory, exotic skins, and traditional medicines from threatened animals…
- 34. A nucleosome is formed when ~146 base pairs of DNA wrap ~1.65 turns around a histone octamer (2 each of H2A, H2B, H3 and H4) forming the core particle; linker DNA connects nucleosomes and histone H1 binds linker DNA to stabilize higher-order chromatin structure.
- 35. Two primary growth models: exponential (geometric) growth dN/dt = rN producing J-shaped curve, and logistic growth dN/dt = rN(1 − N/K) producing S-shaped (sigmoid) curve with carrying capacity K.
- 36. The ABO blood grouping system in humans is controlled by a single gene with three alleles designated as I^A, I^B, and i. These alleles show codominance and complete dominance relationships. The I^A and I^B alleles are codominant to each other, meaning both are expressed when present together. Both I^A and I^B alleles are completely dominant over the recessive i allele. The four possible blood groups result from different combinations of these three alleles. Blood group A individuals have genotype I^A I^A or I^A i, possessing A antigens on red blood cells. Blood group B individuals have genotype I^B I^B or I^B i, possessing B antigens on red blood cells. Blood group AB individuals have gen…
- 37. The placenta is classified as an endocrine tissue because it synthesizes and secretes multiple hormones that regulate pregnancy and fetal development. The placenta produces human chorionic gonadotropin (hCG), which maintains the corpus luteum during early pregnancy and prevents menstruation. It also secretes progesterone, which maintains the uterine lining and prevents uterine contractions. Estrogens produced by the placenta promote uterine growth and prepare the mammary glands for lactation. Human placental lactogen (hPL) is secreted to regulate maternal metabolism and ensure adequate nutrient supply to the fetus. Additionally, the placenta produces relaxin, which softens the pelvic liga…
- 38. J-shaped curve = exponential growth (no carrying capacity); S-shaped curve = logistic growth (includes carrying capacity K).
Brain Grain · braingrain.in
Zoology — Practice Paper · Set 2
Class: 12Samacheer KalviMax Marks: 92
Name: ____________________Reg No: ____________
Part I — Multiple Choice Questions 14 × 1 = 14
Choose the correct answer. (Answer all questions.)
1.Explain the inheritance of sex linked characters in human being.[1]
2.In which of the following phyla, the adult shows radial symmetry but the larva shows bilateral symmetry? a. Mollusca b. Echinodermata c. Arthropoda d. Annelida[1]
3.Why do you think it is not possible to produce vaccine against 'common cold'?[1]
4.Open Book Assessment: 'Healthy reproduction, legally checked birth control measures and proper family planning programmes are essential for the survival of mankind.' Justify.[1]
5.What are the effects of noise pollution?[1]
6.The following is the illustration of the sequence of ovarian events (a-i) in a human female. a) Identify the figure that illustrates ovulation and mention the stage of oogenesis it represents. b) Name the ovarian hormone and the pituitary hormone that have caused the above-mentioned events. c) Explain the changes that occurs in the uterus simultaneously in anticipation. d) Write the difference between C and H.[1]
7.Differentiate between the following: (a) External and Internal fertilization (b) Regeneration in lizard and Planaria[1]
8.What is bioremediation?[1]
9.It is established that RNA is the first genetic material. Justify giving reasons.[1]
10.How does Neanderthal man differ from the modern man in appearance?[1]
11.Tabulate and analysis of two species population interaction.[1]
12.Explain how recombinant insulin can be produced.[1]
13.Write a note on (i) Protected areas and (ii) Wildlife Sanctuaries.[1]
14.Explain the different kinds of syngamy in living organisms.[1]
Part II — Short Answer Questions 14 × 2 = 28
Answer briefly. (Answer all questions.)
15.Expand (i) CFC (ii) AQI (iii) PAN[2]
16.What is Lyonisation?[2]
17.Mention the symptoms of Phenylketonuria.[2]
18.What are the three levels of biodiversity?[2]
19.Given below are some human organs. Identify one primary and one secondary lymphoid organ. Explain its role. Liver, thymus, stomach, thyroid, tonsils[2]
20.What is a Habitat?[2]
21.A - In human male, testes are extra abdominal and lie in scrotal sacs. R - Scrotum acts as thermoregulator and keeps temperature lower by 2°C for normal sperm production. Choose correct relation.[2]
22.What is Pedogenesis?[2]
23.What is soil permeability?[2]
24.What is haplodiploidy?[2]
25.Expand the following a) ZIFT b) ICSI[2]
26.What are holandric genes?[2]
27.Why are sex linked recessive characters more common in the male human beings?[2]
28.What is parthenogenesis? Give two examples from animals.[2]
Part III — Long Answer Questions 10 × 5 = 50
Answer in detail. (Answer all questions.)
29.Explain the various barrier methods to control human population.[5]
30.What is inhibin? State its functions.[5]
31.How is juvenile phase different from reproductive phase?[5]
32.Give any two bioactive molecules produced by microbes and state their uses.[5]
33.Explain the structure of immunoglobulin with suitable diagram.[5]
34.List the common withdrawal symptoms of drugs and alcohol abuse.[5]
35.What is the composition of semen?[5]
36.How is the amplification of a gene sample of interest carried out using PCR?[5]
37.What is Red data book? Mention it purposes.[5]
38.Mention the importance of the position of the testes in humans.[5]
🔑 Show Answer Key — Set 2
- 1. Sex-linked characters in humans are traits controlled by genes located on the sex chromosomes, primarily the X chromosome. Since males have only one X chromosome (XY), they express both dominant and recessive alleles on the X chromosome, making them hemizygous. Females have two X chromosomes (XX), so they can be homozygous or heterozygous for X-linked traits. For X-linked recessive traits like color blindness and hemophilia, affected males have the genotype X^a Y where X^a represents the recessive allele. Carrier females have the genotype X^A X^a (one normal and one mutant allele) and typically show the dominant phenotype but can pass the recessive allele to offspring. When a carrier fema…
- 2. b) Echinodermata Explanation: Echinoderm adults (e.g., sea stars, sea urchins) display radial (usually pentaradial) symmetry, whereas their larvae (for example, bipinnaria or pluteus larvae) are bilaterally symmetrical. This change reflects their planktonic larval stage and sedentary/adult body plan.
- 3. It is not possible to produce an effective vaccine against the common cold due to several interconnected factors related to viral diversity and immune response characteristics. The common cold is caused by more than 100 different virus serotypes, primarily rhinoviruses, but also including coronaviruses, adenoviruses, enteroviruses, and parainfluenza viruses. This extreme antigenic diversity means that immunity to one serotype does not provide protection against others, making a single vaccine impractical. Additionally, these viruses undergo frequent antigenic variation and mutation, allowing them to evade previously acquired immunity. The common cold viruses primarily infect the upper res…
- 4. Healthy reproduction, legally regulated birth control measures, and proper family planning programmes are essential for mankind's survival for several interconnected reasons. Healthy reproduction ensures that children are born with minimal genetic and developmental abnormalities, reducing infant and child mortality and promoting the birth of healthy individuals who can contribute productively to society. Legally checked birth control measures prevent unsafe and unregulated practices that endanger women's health and lives. Proper family planning programmes enable couples to space pregnancies appropriately, reducing maternal and child health risks associated with frequent pregnancies and al…
- 5. Noise pollution produces a wide range of harmful effects on both human health and wildlife. Auditory effects include hearing loss, which can result from prolonged exposure to loud sounds, and tinnitus, a persistent ringing in the ears that can significantly impact quality of life. Physiological stress responses occur when organisms are exposed to excessive noise, leading to elevated blood pressure, increased heart rate, and elevated levels of stress hormones such as cortisol. These physiological changes can contribute to cardiovascular disease and other stress-related health conditions. Sleep disturbance is a major consequence of noise pollution, as continuous or intermittent loud sounds…
- 6. a) The figure showing the ruptured mature (Graafian) follicle illustrates ovulation; it represents release of a secondary oocyte arrested in metaphase II. b) Ovarian hormone: estrogen (produced by the mature follicle); Pituitary hormone: LH (luteinizing hormone surge). c) Uterine changes: endometrium moves from proliferative to secretory phase under progesterone (after corpus luteum forms): becomes thicker, more glandular and vascularized; glands secrete nutrient-rich fluid preparing for implantation. d) Difference between C and H (assumed C = corpus luteum; H = corpus albicans): corpus luteum is yellow, functional, secretes progesterone and some estrogen; corpus albicans is a pale fibrou…
- 7. (a) External fertilization: gametes fuse outside body (aquatic animals, many fishes/amphibians), many small gametes, often large number of offspring and less parental care. Internal fertilization: gametes fuse inside body (terrestrial animals, mammals, birds), fewer gametes, greater parental care. (b) Regeneration: Lizard — limited regeneration (mainly tail) via blastema; replacement is partial and tissue types more restricted. Planaria — extensive regeneration: any small fragment can regenerate whole organism due to abundant pluripotent neoblasts.
- 8. Bioremediation is an environmental biotechnology approach that uses living organisms, primarily microorganisms such as bacteria and fungi, and plants to degrade, detoxify, or remove pollutants and contaminants from contaminated environments. The process can be implemented through two main strategies: in situ bioremediation, where contamination is treated at the site of pollution without removing the contaminated material, and ex situ bioremediation, where contaminated soil or water is excavated or extracted and treated in a controlled facility away from the original site. Microorganisms employed in bioremediation possess enzymatic capabilities to break down various pollutants including pe…
- 9. RNA is considered the first genetic material because it can both store information and act as a catalyst (ribozyme), can self-replicate under plausible prebiotic conditions, and modern evidence (ribozymes, central role of RNA in translation) supports an RNA world preceding DNA/protein biology.
- 10. Neanderthal man (Homo neanderthalensis) differed from modern humans (Homo sapiens) in several significant anatomical features. Neanderthals were more robust and heavily built with a stockier body structure adapted to cold climates, whereas modern humans are more gracile and lightly built. Neanderthals possessed heavy, prominent brow ridges above their eyes, while modern humans have smooth foreheads. The forehead of Neanderthals was low and receding, sloping backward, whereas modern humans have a vertical, prominent forehead. Neanderthals had a large nose, which may have been an adaptation for warming cold air before it entered the lungs, while modern humans have a smaller, more prominent…
- 11. Two-species population interactions can be analyzed and tabulated based on the effects on each species, represented by + (positive effect), − (negative effect), or 0 (no effect). Competition (−/−) occurs when both species are negatively affected as they utilize the same limited resources, reducing fitness and survival of both. Predation and parasitism (+/−) involve one species (predator or parasite) benefiting while the other (prey or host) is harmed; the predator gains nutrition while the prey population decreases. Mutualism (+/+) is a mutually beneficial interaction where both species gain advantages, such as flowering plants and their pollinators or nitrogen-fixing bacteria and legumes…
- 12. Recombinant insulin is produced through a multi-step biotechnological process that involves genetic engineering and protein expression in microbial hosts. The first step is to identify and isolate the human insulin gene or the genes encoding the individual insulin A and B chains, or alternatively, the proinsulin gene, which encodes a single-chain precursor that is later processed into mature insulin. The isolated insulin gene or cDNA is then inserted into an expression vector, which is a plasmid or viral DNA construct containing regulatory sequences such as promoters and terminators that control gene expression. The recombinant expression vector is introduced into a suitable microbial hos…
- 13. Protected areas are designated regions of land or water specifically managed for the conservation of biodiversity, ecosystem services, and genetic resources. They include national parks, wildlife sanctuaries, biosphere reserves, and other conservation designations. Protected areas function as in situ conservation sites where species are protected within their natural habitats and ecological communities are maintained. They serve multiple purposes including preserving representative ecosystems, protecting endangered species, maintaining ecosystem services such as water purification and carbon sequestration, supporting scientific research, and providing educational opportunities. Protected…
- 14. Syngamy refers to the fusion of two gametes to form a zygote, and different types of syngamy are classified based on the morphology and motility of the fusing gametes. Isogamy is the fusion of two morphologically similar and equally motile gametes, as seen in many algae and fungi where both gametes appear identical. Anisogamy involves the fusion of two gametes that differ in size and morphology, where one gamete is larger and less motile than the other, observed in certain algae and protozoans. Oogamy is the fusion of a large, non-motile female gamete (ovum) with a small, motile male gamete (sperm), which is the most common type of syngamy in higher animals and plants. These different typ…
- 15. CFC = Chlorofluorocarbon; AQI = Air Quality Index; PAN = Peroxyacetyl nitrate (Peroxyacyl nitrates).
- 16. Lyonisation is the process of inactivation or silencing of one of the two X chromosomes in female mammals. In female cells, one X chromosome is randomly selected and becomes highly condensed into a structure called a Barr body, rendering most of its genes transcriptionally inactive. This process occurs early in female development and is random, meaning that in some cells the maternal X chromosome is inactivated while in other cells the paternal X chromosome is inactivated. Lyonisation ensures dosage compensation, equalizing X-linked gene expression between males (who have one X chromosome) and females (who have two X chromosomes). This prevents females from having a double dose of X-linke…
- 17. Phenylketonuria (PKU) is an autosomal recessive metabolic disorder caused by deficiency of the enzyme phenylalanine hydroxylase, which normally converts the amino acid phenylalanine to tyrosine. The primary symptoms include severe mental retardation or intellectual disability if the condition is not detected and treated early in life. Affected individuals typically have light pigmentation of the skin and hair due to reduced melanin synthesis, as tyrosine is a precursor for melanin. A characteristic musty or mousy odour is often present in the body odour and urine of affected individuals. Phenylpyruvic acid, a metabolite of phenylalanine, accumulates and is excreted in the urine. Early dia…
- 18. The three levels of biodiversity are genetic diversity, species diversity, and ecosystem diversity. Genetic diversity refers to the variation in genes within a population or species, including different alleles and genetic combinations that provide the raw material for evolution and adaptation. Species diversity encompasses the variety of different species present in an area or on Earth, measured by species richness and evenness. Ecosystem diversity refers to the variety of different ecosystems, habitats, and biomes present across the biosphere, each with unique communities and ecological processes.
- 19. From the given organs, thymus is a primary lymphoid organ and tonsils are a secondary lymphoid organ. The thymus is a primary lymphoid organ located in the chest behind the breastbone where T lymphocytes (T cells) develop and mature. In the thymus, immature T cells undergo selection processes that ensure they can recognize self-antigens appropriately while eliminating those that would attack the body's own cells, thus achieving immunocompetency. The thymus is particularly active during childhood and gradually decreases in size and function with age. Tonsils are secondary lymphoid organs located in the pharynx (throat region) that help defend against pathogens entering through the mouth an…
- 20. A habitat is the specific place or physical environment where an organism or a population normally lives, survives, and reproduces. It encompasses the particular location and all the biotic and abiotic factors present in that location that the organism requires for its survival and growth. For example, a pond serves as the habitat for a frog, providing water, aquatic vegetation, insects for food, and appropriate temperature conditions. An oak tree is the habitat for a woodpecker, offering shelter in cavities, insects for food, and suitable nesting sites. Different organisms have different habitat requirements based on their physiological needs, feeding habits, and behavioral patterns. A h…
- 21. A and R are true, R is the correct explanation of A
- 22. Pedogenesis is the process of soil formation from parent rock through physical, chemical and biological weathering combined with the accumulation of organic matter. Physical weathering involves the mechanical breakdown of rock by temperature fluctuations, frost action, and water erosion. Chemical weathering occurs through oxidation, hydrolysis, and dissolution of minerals by water and acids. Biological weathering is facilitated by plant roots, lichens, fungi, and soil microorganisms that break down rock and contribute organic material. Over time, these processes create distinct soil horizons, with the uppermost layers becoming enriched with humus and developing the characteristics necessa…
- 23. Soil permeability is the ability of soil to allow water and gases to pass through its pore spaces, which is essential for water drainage, aeration, and nutrient availability to plant roots. Permeability depends on several factors including soil texture (the proportion of sand, silt, and clay particles), soil structure (the arrangement and aggregation of particles), and pore connectivity (the degree to which pores are interconnected). Sandy soils generally have high permeability due to larger pore spaces, while clay soils have low permeability because fine particles create smaller, less connected pores. Soil structure, influenced by organic matter content and biological activity, can signi…
- 24. In haplodiploidy, the sex of the offspring is determined by the number of sets of chromosomes it receives. Fertilized eggs develop into females (Queen or Worker) and unfertilized eggs develop into males (drones) by parthenogenesis. It means that the males have half the number of chromosomes (haploid) and the females have double the number (diploid).
- 25. a) ZIFT stands for Zygote Intrafallopian Transfer, a technique in which a fertilized ovum or zygote is collected and transferred into the fallopian tube to allow natural development and implantation. b) ICSI stands for Intracytoplasmic Sperm Injection, a specialized micromanipulation technique used in assisted reproduction in which a single sperm is injected directly into the cytoplasm of a mature oocyte to achieve fertilization, particularly useful in cases of severe male factor infertility.
- 26. Holandric genes are genes present in the differential region of the Y chromosome that have no corresponding alleles on the X chromosome. These genes are found only on the Y chromosome and are therefore exclusive to males. Holandric genes are also called Y-linked genes. Since males have only one Y chromosome and females have none, holandric genes are transmitted directly from father to son and appear in every male descendant of an affected male. These genes do not show the typical criss-cross inheritance pattern seen with X-linked genes. Examples of holandric genes include those controlling male sex determination and spermatogenesis. The inheritance of holandric genes is strictly patriline…
- 27. Sex-linked recessive characters are more common in male human beings because males have only one X chromosome (XY), whereas females have two X chromosomes (XX). In males, a single recessive allele on the X chromosome is expressed phenotypically because there is no corresponding allele on the Y chromosome to mask it. Males are therefore hemizygous for X-linked genes, meaning they have only one copy of each X-linked gene. In contrast, females require two copies of a recessive allele (one on each X chromosome) to express the recessive phenotype. If a female has only one recessive allele, she is a carrier and typically expresses the dominant phenotype. This fundamental difference in chromosom…
- 28. Parthenogenesis is the development of an embryo from an unfertilized egg without the fusion of male and female gametes. It is a form of asexual reproduction where the haploid egg undergoes mitotic divisions to produce a diploid organism. Examples of parthenogenesis in animals include drones (male bees) of the honey bee (Apis), where males develop from unfertilized eggs, certain aphids that reproduce parthenogenetically during favorable seasons, and some whiptail lizards (genus Aspidoscelis) where certain species reproduce entirely through parthenogenesis without males.
- 29. Barrier methods physically prevent sperm from reaching the ovum. Major barrier methods: - Male condom: thin sheath worn over the penis; prevents semen entering the vagina and reduces risk of STDs. - Female (internal) condom: pouch inserted into the vagina; protects against pregnancy and some STDs. - Diaphragm: dome-shaped rubber cup placed over the cervix before intercourse; usually used with spermicidal gel. - Cervical cap: smaller cap fitted over the cervix; used with spermicide. - Vaginal sponge/contraceptive vault: sponge containing spermicide placed over cervix. - Spermicidal creams, gels, foams and suppositories: chemical agents that immobilize/kill sperm; often used with mechanical…
- 30. Inhibin is a peptide hormone secreted by Sertoli cells in the testes of males and by granulosa cells in the ovarian follicles of females. Its primary function is to provide negative feedback inhibition of follicle-stimulating hormone (FSH) secretion from the anterior pituitary gland. In males, inhibin is produced in response to high levels of spermatogenesis and acts to suppress FSH when sperm production is adequate, thereby regulating the rate of spermatogenesis. In females, inhibin is secreted by granulosa cells of developing follicles during the follicular phase of the menstrual cycle and inhibits FSH secretion, which prevents the recruitment and development of additional follicles and…
- 31. The juvenile phase and reproductive phase represent two distinct periods in the life cycle of an organism. The juvenile phase is the growth and maturation period during which the organism develops and increases in size and complexity, but is not yet sexually mature. During this phase, the organism cannot produce gametes and is incapable of reproduction. The reproductive phase begins after the organism attains sexual maturity, typically marked by the onset of puberty in animals. During the reproductive phase, gametogenesis (formation of gametes) occurs, and the organism is capable of sexual reproduction. The transition from juvenile to reproductive phase involves physiological and hormonal…
- 32. Microorganisms produce numerous bioactive molecules with significant medical and industrial applications. Penicillin is produced by the fungus Penicillium notatum or Penicillium chrysogenum and is a beta-lactam antibiotic that inhibits bacterial cell wall synthesis by binding to penicillin-binding proteins and preventing peptidoglycan cross-linking. It is used to treat a wide range of bacterial infections caused by gram-positive and some gram-negative bacteria, making it one of the most important antibiotics in clinical medicine. Cyclosporin A is produced by certain fungi such as Tolypocladium and related Trichoderma species and functions as an immunosuppressive agent by inhibiting T cell…
- 33. Immunoglobulin (Ig) is a Y-shaped molecule of two identical heavy chains and two identical light chains with variable and constant regions forming Fab (antigen-binding) and Fc regions (effector functions).
- 34. Common withdrawal symptoms of drugs and alcohol abuse reflect the body's dependence on these substances and the neurochemical imbalances that occur upon cessation. Psychological symptoms include anxiety, irritability, depression, and intense cravings for the substance. Neurological symptoms include tremors, headaches, insomnia or sleep disturbances, and in severe cases, hallucinations or delirium. Gastrointestinal symptoms include nausea, vomiting, and loss of appetite. Cardiovascular symptoms include increased heart rate and elevated blood pressure. Musculoskeletal symptoms include muscle aches and pain. Autonomic symptoms include sweating and chills. Severe alcohol withdrawal can progre…
- 35. Semen = spermatozoa + seminal plasma (fluid from seminal vesicles, prostate and bulbourethral glands). Major components: sperm cells, fructose, prostaglandins, fibrinogen, alkaline fluid, citric acid, enzymes (prostate-specific antigen), zinc, mucus and buffers.
- 36. PCR amplification of a gene sample of interest is carried out through a series of carefully controlled steps. The reaction mixture is prepared by combining template DNA containing the target sequence, two specific primers (forward and reverse) that flank the region of interest, deoxynucleotide triphosphates (dNTPs) providing the building blocks for DNA synthesis, a buffer solution maintaining optimal pH, magnesium ions (Mg2+) as cofactors for DNA polymerase activity, and heat-stable DNA polymerase, typically Taq polymerase from Thermus aquaticus. The amplification process involves repeated thermal cycling with three distinct temperature phases. During denaturation at approximately 94-95°C…
- 37. The Red Data Book, officially known as the IUCN Red List of Threatened Species, is a comprehensive catalogue of taxa (species, subspecies, varieties) that have been assessed for their risk of extinction. It is maintained by the International Union for Conservation of Nature (IUCN) and provides detailed information on the conservation status of species worldwide. The purposes of the Red Data Book are multifaceted. First, it documents and categorizes species' conservation status using standardized criteria, assigning them to categories such as Extinct, Extinct in the Wild, Critically Endangered, Endangered, Vulnerable, Near Threatened, Least Concern, and Data Deficient. Second, it raises gl…
- 38. The testes are located in the scrotum, which is positioned outside the abdominal cavity, rather than remaining in the abdomen where they develop during fetal life. This external location is of critical importance because it allows the testes to maintain a temperature approximately 2 to 4 degrees Celsius below the core body temperature. This lower temperature is essential for normal spermatogenesis, the process of sperm formation. The seminiferous tubules and developing germ cells are highly sensitive to elevated temperatures, and exposure to temperatures as high as normal body temperature results in impaired meiosis, reduced sperm motility, decreased sperm viability, and ultimately male i…
Brain Grain · braingrain.in
Zoology — Practice Paper · Set 3
Class: 12Samacheer KalviMax Marks: 92
Name: ____________________Reg No: ____________
Part I — Multiple Choice Questions 14 × 1 = 14
Choose the correct answer. (Answer all questions.)
1.In which of the following phyla, the adult shows radial symmetry but the larva shows bilateral symmetry? a. Mollusca b. Echinodermata c. Arthropoda d. Annelida[1]
2.Why do you think it is not possible to produce vaccine against 'common cold'?[1]
3.Open Book Assessment: 'Healthy reproduction, legally checked birth control measures and proper family planning programmes are essential for the survival of mankind.' Justify.[1]
4.What are the effects of noise pollution?[1]
5.The following is the illustration of the sequence of ovarian events (a-i) in a human female. a) Identify the figure that illustrates ovulation and mention the stage of oogenesis it represents. b) Name the ovarian hormone and the pituitary hormone that have caused the above-mentioned events. c) Explain the changes that occurs in the uterus simultaneously in anticipation. d) Write the difference between C and H.[1]
6.Differentiate between the following: (a) External and Internal fertilization (b) Regeneration in lizard and Planaria[1]
7.What is bioremediation?[1]
8.It is established that RNA is the first genetic material. Justify giving reasons.[1]
9.How does Neanderthal man differ from the modern man in appearance?[1]
10.Tabulate and analysis of two species population interaction.[1]
11.Explain how recombinant insulin can be produced.[1]
12.Write a note on (i) Protected areas and (ii) Wildlife Sanctuaries.[1]
13.Explain the different kinds of syngamy in living organisms.[1]
14.Explain the inheritance of sex linked characters in human being.[1]
Part II — Short Answer Questions 14 × 2 = 28
Answer briefly. (Answer all questions.)
15.Expand the acronyms a. FSH b. LH c. hCG d. hPL[2]
16.Name the phenomenon where the female gamete directly develops into a new organism with an avian example.[2]
17.What are the applications of Karyotyping?[2]
18.Select the correct term from the bracket and complete the given branching tree Birth control methods Condoms, vaults, Caps etc., Pills Vasectomy B Coitus interruptus Periodic abstinence Natural methods A Oral contraceptives Surgical methods IUDs (Barriers, Lactational amenorrhoea, CuT, Tubectomy) 44 Reprod u c t i v e Health 7HPSRUDU\ PHWKRG 3HUPDQHQW 0HWKRG 7XEHFWRP\ 9DVHFWRP\ 3URJHVWDVHUW /1* &X 7 $ 1RYD 7 &X &X7 $J 0XOWLORDG +RUPRQDO EDUULHU 'LDSKUDJP &HUYLFDO FDS 9DXOWV &RQGRP 0HFKDQLFDO EDUULHU %DUULHU PHWKRG &KHPLFDO EDUULHU 3HULRGLF DEVWLQHQFH UK\WKP PHWKRG &RQWLQXRXV DEVWLQHQFH &RLWXV LQWHUUXSWXV /DFWDWLRQDO $PHQRUUKRHD 1DWXUDO PHWKRG 2UDO FRQWUDFHSWLYHV %,57+ &21752/ 0(7+2'6 1RQ PHGLFDWHG ,8'V +RUPRQDO UHOHDVLQJ ,8'V &RSSHU UHOHDVLQJ ,8'V /LSSHV ORRS 0LQL SLOOV 6DKHOL FHQWFKURPDQ )RDPLQJ WDEOHWV PHOWLQJ VXSSRVLWRULHV MHOOLHV DQG FUHDPV ,QWUDXWHULQH 'HYLFHV[2]
19.Name an organism where cell division is itself a mode of reproduction.[2]
20.A - Head of the sperm consists of acrosome and mitochondria. R - Acrosome contains spiral rows of mitochondria. Choose correct relation.[2]
21.A - Ovulation is the release of ovum from the Graafian follicle. R - It occurs during the follicular phase of the menstrual cycle. Choose correct relation.[2]
22.List out the major gases seems to be found in the primitive earth.[2]
23.If the coding sequence in a transcription unit is written as follows: 5' TGCATGCATGCATGCATGCATGCATGC 3' Write down the sequence of mRNA.[2]
24.A patient was hospitalized with fever and chills. Merozoites were observed in her blood. What is your diagnosis?[2]
25.What is criss-cross inheritance?[2]
26.Differentiate between Eurytherms and Stenotherms.[2]
27.What is Acclimatisation?[2]
28.Name the active chemical found in the medicinal plant Rauwolfia vomitoria. What type of diversity it belongs to?[2]
Part III — Long Answer Questions 10 × 5 = 50
Answer in detail. (Answer all questions.)
29.(i) Write the scientific name of the filarial worm that causes filariasis. (ii) Write the symptoms of filariasis. (iii) How is this disease transmitted?[5]
30.If a person thinks he is infected with HIV, due to unprotected sex, and goes for a blood test. Do you think a test such as ELISA will help? If so why? If not, why?[5]
31.Autoimmunity is a misdirected immune response. Justify.[5]
32.Differentiate Natality and Mortality.[5]
33.What is vaccine? What are its types?[5]
34.What is SMOG and how it is harmful for us?[5]
35.From their examination of the structure of DNA, what did Watson and Crick infer about the probable mechanism of DNA replication, coding capability and mutation?[5]
36.Explain the process of fertilization and implantation of the fertilized ovum.[5]
37.List the causative agent, mode of transmission and symptoms for Diphtheria and Typhoid.[5]
38.A low level of expression of lac operon occurs at all the time. Justify the statement.[5]
🔑 Show Answer Key — Set 3
- 1. b) Echinodermata Explanation: Echinoderm adults (e.g., sea stars, sea urchins) display radial (usually pentaradial) symmetry, whereas their larvae (for example, bipinnaria or pluteus larvae) are bilaterally symmetrical. This change reflects their planktonic larval stage and sedentary/adult body plan.
- 2. It is not possible to produce an effective vaccine against the common cold due to several interconnected factors related to viral diversity and immune response characteristics. The common cold is caused by more than 100 different virus serotypes, primarily rhinoviruses, but also including coronaviruses, adenoviruses, enteroviruses, and parainfluenza viruses. This extreme antigenic diversity means that immunity to one serotype does not provide protection against others, making a single vaccine impractical. Additionally, these viruses undergo frequent antigenic variation and mutation, allowing them to evade previously acquired immunity. The common cold viruses primarily infect the upper res…
- 3. Healthy reproduction, legally regulated birth control measures, and proper family planning programmes are essential for mankind's survival for several interconnected reasons. Healthy reproduction ensures that children are born with minimal genetic and developmental abnormalities, reducing infant and child mortality and promoting the birth of healthy individuals who can contribute productively to society. Legally checked birth control measures prevent unsafe and unregulated practices that endanger women's health and lives. Proper family planning programmes enable couples to space pregnancies appropriately, reducing maternal and child health risks associated with frequent pregnancies and al…
- 4. Noise pollution produces a wide range of harmful effects on both human health and wildlife. Auditory effects include hearing loss, which can result from prolonged exposure to loud sounds, and tinnitus, a persistent ringing in the ears that can significantly impact quality of life. Physiological stress responses occur when organisms are exposed to excessive noise, leading to elevated blood pressure, increased heart rate, and elevated levels of stress hormones such as cortisol. These physiological changes can contribute to cardiovascular disease and other stress-related health conditions. Sleep disturbance is a major consequence of noise pollution, as continuous or intermittent loud sounds…
- 5. a) The figure showing the ruptured mature (Graafian) follicle illustrates ovulation; it represents release of a secondary oocyte arrested in metaphase II. b) Ovarian hormone: estrogen (produced by the mature follicle); Pituitary hormone: LH (luteinizing hormone surge). c) Uterine changes: endometrium moves from proliferative to secretory phase under progesterone (after corpus luteum forms): becomes thicker, more glandular and vascularized; glands secrete nutrient-rich fluid preparing for implantation. d) Difference between C and H (assumed C = corpus luteum; H = corpus albicans): corpus luteum is yellow, functional, secretes progesterone and some estrogen; corpus albicans is a pale fibrou…
- 6. (a) External fertilization: gametes fuse outside body (aquatic animals, many fishes/amphibians), many small gametes, often large number of offspring and less parental care. Internal fertilization: gametes fuse inside body (terrestrial animals, mammals, birds), fewer gametes, greater parental care. (b) Regeneration: Lizard — limited regeneration (mainly tail) via blastema; replacement is partial and tissue types more restricted. Planaria — extensive regeneration: any small fragment can regenerate whole organism due to abundant pluripotent neoblasts.
- 7. Bioremediation is an environmental biotechnology approach that uses living organisms, primarily microorganisms such as bacteria and fungi, and plants to degrade, detoxify, or remove pollutants and contaminants from contaminated environments. The process can be implemented through two main strategies: in situ bioremediation, where contamination is treated at the site of pollution without removing the contaminated material, and ex situ bioremediation, where contaminated soil or water is excavated or extracted and treated in a controlled facility away from the original site. Microorganisms employed in bioremediation possess enzymatic capabilities to break down various pollutants including pe…
- 8. RNA is considered the first genetic material because it can both store information and act as a catalyst (ribozyme), can self-replicate under plausible prebiotic conditions, and modern evidence (ribozymes, central role of RNA in translation) supports an RNA world preceding DNA/protein biology.
- 9. Neanderthal man (Homo neanderthalensis) differed from modern humans (Homo sapiens) in several significant anatomical features. Neanderthals were more robust and heavily built with a stockier body structure adapted to cold climates, whereas modern humans are more gracile and lightly built. Neanderthals possessed heavy, prominent brow ridges above their eyes, while modern humans have smooth foreheads. The forehead of Neanderthals was low and receding, sloping backward, whereas modern humans have a vertical, prominent forehead. Neanderthals had a large nose, which may have been an adaptation for warming cold air before it entered the lungs, while modern humans have a smaller, more prominent…
- 10. Two-species population interactions can be analyzed and tabulated based on the effects on each species, represented by + (positive effect), − (negative effect), or 0 (no effect). Competition (−/−) occurs when both species are negatively affected as they utilize the same limited resources, reducing fitness and survival of both. Predation and parasitism (+/−) involve one species (predator or parasite) benefiting while the other (prey or host) is harmed; the predator gains nutrition while the prey population decreases. Mutualism (+/+) is a mutually beneficial interaction where both species gain advantages, such as flowering plants and their pollinators or nitrogen-fixing bacteria and legumes…
- 11. Recombinant insulin is produced through a multi-step biotechnological process that involves genetic engineering and protein expression in microbial hosts. The first step is to identify and isolate the human insulin gene or the genes encoding the individual insulin A and B chains, or alternatively, the proinsulin gene, which encodes a single-chain precursor that is later processed into mature insulin. The isolated insulin gene or cDNA is then inserted into an expression vector, which is a plasmid or viral DNA construct containing regulatory sequences such as promoters and terminators that control gene expression. The recombinant expression vector is introduced into a suitable microbial hos…
- 12. Protected areas are designated regions of land or water specifically managed for the conservation of biodiversity, ecosystem services, and genetic resources. They include national parks, wildlife sanctuaries, biosphere reserves, and other conservation designations. Protected areas function as in situ conservation sites where species are protected within their natural habitats and ecological communities are maintained. They serve multiple purposes including preserving representative ecosystems, protecting endangered species, maintaining ecosystem services such as water purification and carbon sequestration, supporting scientific research, and providing educational opportunities. Protected…
- 13. Syngamy refers to the fusion of two gametes to form a zygote, and different types of syngamy are classified based on the morphology and motility of the fusing gametes. Isogamy is the fusion of two morphologically similar and equally motile gametes, as seen in many algae and fungi where both gametes appear identical. Anisogamy involves the fusion of two gametes that differ in size and morphology, where one gamete is larger and less motile than the other, observed in certain algae and protozoans. Oogamy is the fusion of a large, non-motile female gamete (ovum) with a small, motile male gamete (sperm), which is the most common type of syngamy in higher animals and plants. These different typ…
- 14. Sex-linked characters in humans are traits controlled by genes located on the sex chromosomes, primarily the X chromosome. Since males have only one X chromosome (XY), they express both dominant and recessive alleles on the X chromosome, making them hemizygous. Females have two X chromosomes (XX), so they can be homozygous or heterozygous for X-linked traits. For X-linked recessive traits like color blindness and hemophilia, affected males have the genotype X^a Y where X^a represents the recessive allele. Carrier females have the genotype X^A X^a (one normal and one mutant allele) and typically show the dominant phenotype but can pass the recessive allele to offspring. When a carrier fema…
- 15. a. FSH — Follicle Stimulating Hormone b. LH — Luteinizing Hormone c. hCG — human Chorionic Gonadotropin d. hPL — human Placental Lactogen
- 16. The phenomenon where the female gamete directly develops into a new organism without fertilization is called parthenogenesis. An avian example is the domestic turkey (Meleagris gallopavo), where unfertilized eggs can develop into offspring. In this process, the haploid egg undergoes mitotic divisions to produce a diploid organism, bypassing the need for male gamete fusion. This form of asexual reproduction is particularly common in certain bird species and some other animals.
- 17. * Karyotyping helps in gender identification. * It is used to detect the chromosomal aberrations like deletion, duplication, translocation, non-disjunction of chromosomes. * It helps to identify the abnormalities of chromosomes like aneuploidy. * It is also used in predicting the evolutionary relationships between species. * Genetic diseases in human beings can be detected by this technique.
- 18. A — Barriers (e.g., condoms, caps, vaults) B — Lactational amenorrhoea (natural method) C — CuT (IUD) D — Tubectomy (surgical method)
- 19. Amoeba is an organism where cell division itself serves as a mode of reproduction. In amoeba, the unicellular body undergoes binary fission, a form of asexual reproduction where the parent cell divides into two identical daughter cells. This process involves mitotic division of the nucleus followed by division of the cytoplasm, resulting in two genetically identical offspring. Binary fission is a simple and rapid method of reproduction that allows amoeba to increase its population quickly under favorable conditions.
- 20. Both A and R are false
- 21. A is true, R is false
- 22. Major gases of primitive Earth: methane (CH4), ammonia (NH3), hydrogen (H2), water vapour (H2O), nitrogen (N2) and carbon dioxide (CO2).
- 23. The mRNA sequence transcribed from the given DNA coding sequence is synthesized in the 5'→3' direction, with uracil replacing thymine. Since the DNA coding sequence is 5' TGCATGCATGCATGCATGCATGCATGC 3', the corresponding mRNA sequence (5'→3') is 5' UGCAUGCAUGCAUGCAUGCAUGCAUGC 3', where each thymine (T) in the DNA is replaced by uracil (U) in the RNA, and all other bases remain the same.
- 24. The diagnosis is malaria, an infectious disease caused by Plasmodium species parasites. The presence of merozoites in the blood is a characteristic finding that confirms malaria infection. Merozoites are the asexual stage of the Plasmodium parasite that are released from infected red blood cells and invade new erythrocytes, causing their rupture and the characteristic fever and chills associated with malaria. The fever and chills pattern corresponds to the synchronized rupture of infected red blood cells at regular intervals, typically every 48 or 72 hours depending on the Plasmodium species involved. Microscopic examination of blood smears showing merozoites, along with clinical symptoms…
- 25. Criss-cross inheritance is the pattern of inheritance of X-linked genes where the trait appears to skip generations or pass from one sex to the other in an alternating pattern. In this inheritance pattern, a gene is transmitted from an affected male parent to his carrier daughter (who is phenotypically normal if the allele is recessive) and then to an affected grandson through the daughter. Alternatively, a carrier female can pass the recessive allele to her son who expresses the trait, and then the trait can reappear in the granddaughter if she inherits the allele from her affected father. The characteristic criss-cross pattern occurs because males have only one X chromosome, so they exp…
- 26. Eurytherms are organisms that can tolerate a wide range of temperatures and thrive across different thermal environments, maintaining normal metabolic and physiological functions over a broad temperature spectrum. Examples include many mammals, birds, insects, and plants found in diverse climates. Stenotherms, in contrast, can tolerate only a narrow temperature range and are restricted to specific thermal habitats; they have limited ability to adjust their physiology to temperature changes. Examples include many tropical fish, reptiles, and organisms adapted to stable thermal environments like deep ocean waters or polar regions. This difference reflects their evolutionary adaptation to di…
- 27. Acclimatisation is the reversible physiological, morphological or behavioural adjustment of an individual organism to changes in its environment. These adjustments occur within the lifetime of an organism and allow it to cope with environmental stress or variation. A classic example is the increase in red blood cell production in humans at high altitude, which enhances oxygen-carrying capacity in response to lower atmospheric oxygen. Other examples include thickening of skin in response to cold, changes in enzyme activity to match temperature fluctuations, and behavioral modifications such as altered feeding patterns or activity timing. Unlike adaptation, which is a genetic change occurri…
- 28. The active chemical found in the medicinal plant Rauwolfia vomitoria is reserpine, an alkaloid used in treating hypertension and psychiatric disorders. Reserpine exemplifies biochemical diversity, which is a facet of genetic diversity. Biochemical diversity refers to the variety of chemical compounds and metabolites produced by different organisms, reflecting the genetic differences that encode the enzymes and pathways for synthesizing these compounds. This diversity has immense value for medicine, agriculture, and industry.
- 29. (i) The scientific name of the filarial worm that causes filariasis is Wuchereria bancrofti, which is responsible for the majority of filariasis cases worldwide. Brugia malayi and Brugia timori are also important causative agents in certain regions, particularly in Southeast Asia. (ii) Symptoms of filariasis result from lymphatic obstruction caused by adult worms living in lymphatic vessels and nodes. These include lymphedema and swelling of limbs and genitalia, a condition called elephantiasis where affected areas become grossly enlarged and thickened due to chronic inflammation and fibrosis. Patients experience recurrent fever, lymphangitis (inflammation of lymphatic vessels), and in ma…
- 30. Yes, ELISA will be helpful for diagnosing HIV infection, but with important limitations and timing considerations. ELISA detects anti-HIV antibodies produced by the immune system in response to HIV infection. These antibodies typically appear within two to twelve weeks after exposure, a period known as the window period. During this early window period, an infected person may test negative on ELISA despite being infected and capable of transmitting the virus, which is a critical limitation. After the window period has passed, ELISA becomes highly reliable and sensitive for detecting HIV antibodies. However, for detection during the window period, alternative or complementary tests are nec…
- 31. Autoimmunity represents a fundamental failure of immune tolerance, wherein the immune system misdirects its protective mechanisms against the body's own tissues and cells. Normally, self-tolerance is maintained through central tolerance in the thymus and bone marrow, where self-reactive lymphocytes are eliminated, and peripheral tolerance, where regulatory T cells and other mechanisms suppress autoreactive cells. When self-tolerance fails, autoreactive B cells produce autoantibodies against self-antigens, and autoreactive T cells directly attack self-tissues, causing chronic inflammation and tissue damage. This misdirected response occurs due to genetic predisposition, environmental trigg…
- 32. Natality and mortality are two fundamental demographic parameters that determine population change. Natality, also called the birth rate, is the number of births per unit population per unit time, typically expressed as births per 1000 individuals per year. It represents the rate at which new individuals are added to a population through reproduction. Natality is influenced by factors such as age structure, reproductive capacity, availability of resources, and environmental conditions. Mortality, also called the death rate, is the number of deaths per unit population per unit time, similarly expressed as deaths per 1000 individuals per year. It represents the rate at which individuals are…
- 33. A vaccine is a preparation containing weakened or inactivated pathogens, pathogenic antigens, or genetic material that stimulates protective immunity against a specific disease without causing the disease itself. Vaccines work by priming the adaptive immune system to recognize and respond rapidly to the actual pathogen upon future exposure. Several types of vaccines are used clinically. Live attenuated vaccines contain weakened forms of the pathogen that can still replicate but cause little or no disease, providing strong immunity. Killed or inactivated vaccines contain pathogens that have been chemically or physically inactivated, making them safe but sometimes requiring booster doses. S…
- 34. Smog is a form of air pollution that results from a mixture of smoke, fog, and photochemical pollutants. It typically forms when sunlight reacts with nitrogen oxides and volatile organic compounds in the atmosphere, producing secondary pollutants including ground-level ozone, peroxyacetyl nitrate (PAN), and various particulate matter. Smog appears as a visible haze that reduces atmospheric visibility and can range in color from gray to brown depending on pollutant composition. Smog is harmful to human health in multiple ways. It causes respiratory irritation affecting the nose, throat, and lungs, triggering coughing and discomfort. It aggravates pre-existing respiratory conditions such as…
- 35. Watson and Crick inferred three fundamental mechanisms from DNA structure. First, they proposed that DNA replication is semi-conservative, occurring through complementary base pairing where each strand of the double helix serves as a template for a new strand, ensuring accurate copying of genetic information. Second, they recognized that the genetic information is encoded in the linear sequence of bases along the DNA molecule, with the specific order of adenine, thymine, guanine, and cytosine determining the genetic code and providing the coding capability for all hereditary traits. Third, they understood that mutations arise from changes or alterations in the base sequence of DNA, and th…
- 36. Fertilization is the fusion of male and female gametes to form a diploid zygote and occurs in the ampulla of the fallopian tube. The process begins with capacitation, during which spermatozoa undergo biochemical changes in the female reproductive tract that enhance their fertilizing ability. As the sperm approaches the ovum, the acrosome reaction occurs, in which enzymes from the acrosome are released to digest the corona radiata and the zona pellucida, the protective layers surrounding the oocyte. The sperm penetrates these barriers and fuses with the oocyte plasma membrane. Upon sperm entry, the cortical reaction is triggered, in which cortical granules release their contents to harden…
- 37. Diphtheria is caused by the bacterium Corynebacterium diphtheriae and is transmitted through respiratory droplets from infected individuals or carriers. Symptoms include a sore throat, fever, and formation of a characteristic pseudomembrane (false membrane) in the throat that appears grayish-white and can obstruct the airway. Lymphadenopathy (swollen lymph nodes in the neck) creates a characteristic bull-neck appearance. The bacterium produces a potent exotoxin that can cause myocarditis (inflammation of the heart muscle) leading to arrhythmias and heart failure, and nerve palsies affecting cranial nerves, particularly the vagus nerve, causing paralysis of the soft palate and respiratory…
- 38. A low level of expression of the lac operon occurs at all times because the interaction between the lac repressor protein and the operator is dynamic and not absolute. Although the repressor protein binds to the operator in the absence of lactose and blocks transcription, this binding is not permanent or complete. The repressor protein occasionally dissociates from the operator due to thermal fluctuations and molecular dynamics, allowing RNA polymerase to briefly access the promoter and transcribe the structural genes. Additionally, the repression is not 100 percent efficient, resulting in incomplete repression and allowing some basal or leaky transcription of the lac operon even when lac…